Incidental Mutation 'R3975:Ceacam16'
ID312600
Institutional Source Beutler Lab
Gene Symbol Ceacam16
Ensembl Gene ENSMUSG00000014686
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 16
SynonymsLOC330483
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3975 (G1)
Quality Score200
Status Validated
Chromosome7
Chromosomal Location19852097-19861299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19853612 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 410 (Q410H)
Ref Sequence ENSEMBL: ENSMUSP00000014830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014830] [ENSMUST00000172815] [ENSMUST00000208198]
Predicted Effect probably damaging
Transcript: ENSMUST00000014830
AA Change: Q410H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014830
Gene: ENSMUSG00000014686
AA Change: Q410H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 129 4.04e0 SMART
IG 140 221 2.5e-4 SMART
IGc2 244 301 4.43e-5 SMART
IG 324 423 1.12e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172815
Predicted Effect probably benign
Transcript: ENSMUST00000208198
Meta Mutation Damage Score 0.2095 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted glycoprotein that in mouse interacts with tectorial membrane proteins in the inner ear. The encoded adhesion protein is found in cochlear outer hair cells and appears to be important for proper hearing over an extended frequency range. Defects in this gene likely are a cause of non-syndromic autosomal dominant hearing loss. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired hearing at low and high frequencies. Mice homozygous for a different knock-out allele show altered tectorial membrane structure and enhanced spontaneous, stimulus-frequency, and transiently evoked otoacoustic emissions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Ceacam16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Ceacam16 APN 7 19861129 missense probably benign
IGL02643:Ceacam16 APN 7 19861161 unclassified probably benign
R1793:Ceacam16 UTSW 7 19856116 missense probably damaging 1.00
R1830:Ceacam16 UTSW 7 19858878 missense possibly damaging 0.90
R2153:Ceacam16 UTSW 7 19861141 missense probably benign
R3980:Ceacam16 UTSW 7 19858633 missense probably benign
R4433:Ceacam16 UTSW 7 19853589 missense possibly damaging 0.65
R4634:Ceacam16 UTSW 7 19858606 missense probably benign
R5839:Ceacam16 UTSW 7 19856083 nonsense probably null
R5973:Ceacam16 UTSW 7 19856337 missense probably damaging 1.00
R6167:Ceacam16 UTSW 7 19861257 unclassified probably benign
R6969:Ceacam16 UTSW 7 19852305 makesense probably null
R7648:Ceacam16 UTSW 7 19852278 missense unknown
Predicted Primers PCR Primer
(F):5'- GTATACCTTGGTGGACGTCATC -3'
(R):5'- CTGCTAGTCTATGCCTGGTATCG -3'

Sequencing Primer
(F):5'- CGTCATCGTTTGAGAGGCAAG -3'
(R):5'- CTATGCCTGGTATCGTGGACC -3'
Posted On2015-04-30