Incidental Mutation 'R3975:Bckdha'
ID 312601
Institutional Source Beutler Lab
Gene Symbol Bckdha
Ensembl Gene ENSMUSG00000060376
Gene Name branched chain ketoacid dehydrogenase E1, alpha polypeptide
Synonyms BCKAD E1[a]
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R3975 (G1)
Quality Score 221
Status Validated
Chromosome 7
Chromosomal Location 25329371-25358178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25330858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 53 (D53Y)
Ref Sequence ENSEMBL: ENSMUSP00000146018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071329] [ENSMUST00000076034] [ENSMUST00000205281] [ENSMUST00000205808] [ENSMUST00000206940]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071329
AA Change: D303Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071292
Gene: ENSMUSG00000060376
AA Change: D303Y

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
Pfam:E1_dh 107 407 2.9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076034
SMART Domains Protein: ENSMUSP00000092277
Gene: ENSMUSG00000059479

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:Galactosyl_T 154 344 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205281
Predicted Effect probably damaging
Transcript: ENSMUST00000205808
AA Change: D53Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206824
Predicted Effect probably benign
Transcript: ENSMUST00000206940
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ccn6 C G 10: 39,031,094 (GRCm39) C143S probably damaging Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Or8k40 T A 2: 86,584,887 (GRCm39) H65L probably damaging Het
Orm3 A T 4: 63,274,395 (GRCm39) probably null Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Rara T G 11: 98,861,395 (GRCm39) I236S probably damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tap1 C A 17: 34,408,541 (GRCm39) probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Thrb A G 14: 18,033,456 (GRCm38) I406M probably damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Bckdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Bckdha APN 7 25,332,767 (GRCm39) missense probably benign 0.00
IGL01322:Bckdha APN 7 25,358,132 (GRCm39) missense possibly damaging 0.75
IGL02279:Bckdha APN 7 25,330,534 (GRCm39) missense probably damaging 1.00
R0071:Bckdha UTSW 7 25,329,868 (GRCm39) splice site probably null
R0071:Bckdha UTSW 7 25,329,868 (GRCm39) splice site probably null
R0194:Bckdha UTSW 7 25,330,875 (GRCm39) missense probably damaging 1.00
R0615:Bckdha UTSW 7 25,341,210 (GRCm39) missense probably benign 0.00
R1806:Bckdha UTSW 7 25,330,845 (GRCm39) missense probably damaging 1.00
R2520:Bckdha UTSW 7 25,341,124 (GRCm39) missense probably benign 0.18
R3847:Bckdha UTSW 7 25,331,077 (GRCm39) missense probably damaging 1.00
R4630:Bckdha UTSW 7 25,330,884 (GRCm39) missense probably damaging 1.00
R5655:Bckdha UTSW 7 25,329,789 (GRCm39) missense probably damaging 1.00
R6030:Bckdha UTSW 7 25,330,866 (GRCm39) missense probably damaging 1.00
R6030:Bckdha UTSW 7 25,330,866 (GRCm39) missense probably damaging 1.00
R7961:Bckdha UTSW 7 25,330,903 (GRCm39) missense probably damaging 1.00
R8202:Bckdha UTSW 7 25,329,738 (GRCm39) missense probably damaging 1.00
R8344:Bckdha UTSW 7 25,330,872 (GRCm39) missense probably damaging 1.00
R8932:Bckdha UTSW 7 25,330,436 (GRCm39) missense probably damaging 0.99
R9089:Bckdha UTSW 7 25,341,144 (GRCm39) missense probably benign 0.03
R9782:Bckdha UTSW 7 25,340,880 (GRCm39) critical splice donor site probably null
Z1176:Bckdha UTSW 7 25,330,568 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGACCTCGTCCACCGAAC -3'
(R):5'- TCCCTGATGGTGTCTGACAG -3'

Sequencing Primer
(F):5'- TACGCTGAGCTGTCGTCACTG -3'
(R):5'- CCCTGATGGTGTCTGACAGTAAGG -3'
Posted On 2015-04-30