Mutagenetix > Incidental Mutation

Incidental Mutation 'R3975:Olfr693'

312602

Institutional Source

Beutler Lab

Gene Symbol

Olfr693

Ensembl Gene

ENSMUSG00000051680

Gene Name

olfactory receptor 693

Synonyms

GA_x6K02T2PBJ9-9055944-9054994, MOR283-8

MMRRC Submission

040939-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106675005-106680584 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106677785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 234 (R234G)

Ref Sequence

ENSEMBL: ENSMUSP00000150203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057817] [ENSMUST00000215541]

AlphaFold

Q8VF89

Predicted Effect

probably damaging
Transcript: ENSMUST00000057817
AA Change: R234G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000059679
Gene: ENSMUSG00000051680
AA Change: R234G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	5.2e-48	PFAM
Pfam:7tm_1	41	290	5.7e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215541
AA Change: R234G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.2922

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Olfr693

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Olfr693	APN	7	106677833	missense	probably damaging	1.00
IGL01135:Olfr693	APN	7	106678193	missense	probably benign	0.41
IGL03247:Olfr693	APN	7	106677547	missense	probably benign	0.01
R0206:Olfr693	UTSW	7	106677574	missense	probably benign	0.03
R1125:Olfr693	UTSW	7	106678007	missense	possibly damaging	0.46
R1873:Olfr693	UTSW	7	106678484	start codon destroyed	probably damaging	1.00
R1969:Olfr693	UTSW	7	106677670	missense	probably damaging	0.99
R1970:Olfr693	UTSW	7	106677670	missense	probably damaging	0.99
R1971:Olfr693	UTSW	7	106677670	missense	probably damaging	0.99
R1972:Olfr693	UTSW	7	106678219	missense	probably benign	0.01
R1973:Olfr693	UTSW	7	106678219	missense	probably benign	0.01
R2570:Olfr693	UTSW	7	106677667	missense	probably benign	0.41
R4840:Olfr693	UTSW	7	106678123	missense	probably damaging	1.00
R5569:Olfr693	UTSW	7	106678483	start codon destroyed	probably null	1.00
R6759:Olfr693	UTSW	7	106677893	missense	probably benign
R6842:Olfr693	UTSW	7	106677886	missense	probably damaging	1.00
R7108:Olfr693	UTSW	7	106678048	missense	probably benign	0.03
R7565:Olfr693	UTSW	7	106678126	missense	probably damaging	1.00
R7800:Olfr693	UTSW	7	106677574	missense	probably benign	0.03
R9225:Olfr693	UTSW	7	106677769	missense	probably benign	0.01
X0025:Olfr693	UTSW	7	106678249	missense	probably damaging	1.00
Z1088:Olfr693	UTSW	7	106678457	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGGACTCTCTTCAAAGCCCC -3'
(R):5'- CCCGGGAGATTAGACACCTTTTC -3'

Sequencing Primer
(F):5'- TCTCTTCAAAGCCCCACTGAC -3'
(R):5'- GATTAGACACCTTTTCTGTGAGATCC -3'

Posted On

2015-04-30