Incidental Mutation 'R3975:Olfr693'
List |< first << previous [record 32 of 60] next >> last >|
ID312602
Institutional Source Beutler Lab
Gene Symbol Olfr693
Ensembl Gene ENSMUSG00000051680
Gene Nameolfactory receptor 693
SynonymsGA_x6K02T2PBJ9-9055944-9054994, MOR283-8
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106675005-106680584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106677785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 234 (R234G)
Ref Sequence ENSEMBL: ENSMUSP00000150203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057817] [ENSMUST00000215541]
Predicted Effect probably damaging
Transcript: ENSMUST00000057817
AA Change: R234G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059679
Gene: ENSMUSG00000051680
AA Change: R234G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-48 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215541
AA Change: R234G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.2922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Olfr693
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Olfr693 APN 7 106677833 missense probably damaging 1.00
IGL01135:Olfr693 APN 7 106678193 missense probably benign 0.41
IGL03247:Olfr693 APN 7 106677547 missense probably benign 0.01
R0206:Olfr693 UTSW 7 106677574 missense probably benign 0.03
R1125:Olfr693 UTSW 7 106678007 missense possibly damaging 0.46
R1873:Olfr693 UTSW 7 106678484 start codon destroyed probably damaging 1.00
R1969:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1970:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1971:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1972:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R1973:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R2570:Olfr693 UTSW 7 106677667 missense probably benign 0.41
R4840:Olfr693 UTSW 7 106678123 missense probably damaging 1.00
R5569:Olfr693 UTSW 7 106678483 start codon destroyed probably null 1.00
R6759:Olfr693 UTSW 7 106677893 missense probably benign
R6842:Olfr693 UTSW 7 106677886 missense probably damaging 1.00
R7108:Olfr693 UTSW 7 106678048 missense probably benign 0.03
R7565:Olfr693 UTSW 7 106678126 missense probably damaging 1.00
R7800:Olfr693 UTSW 7 106677574 missense probably benign 0.03
X0025:Olfr693 UTSW 7 106678249 missense probably damaging 1.00
Z1088:Olfr693 UTSW 7 106678457 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGACTCTCTTCAAAGCCCC -3'
(R):5'- CCCGGGAGATTAGACACCTTTTC -3'

Sequencing Primer
(F):5'- TCTCTTCAAAGCCCCACTGAC -3'
(R):5'- GATTAGACACCTTTTCTGTGAGATCC -3'
Posted On2015-04-30