Incidental Mutation 'R3975:Smad6'
ID312605
Institutional Source Beutler Lab
Gene Symbol Smad6
Ensembl Gene ENSMUSG00000036867
Gene NameSMAD family member 6
SynonymsMadh6, b2b390Clo, Smad 6
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R3975 (G1)
Quality Score102
Status Validated
Chromosome9
Chromosomal Location63953076-64022059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64020930 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 32 (V32A)
Ref Sequence ENSEMBL: ENSMUSP00000036285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041029] [ENSMUST00000179458]
Predicted Effect probably benign
Transcript: ENSMUST00000041029
AA Change: V32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036285
Gene: ENSMUSG00000036867
AA Change: V32A

DomainStartEndE-ValueType
Blast:DWA 2 143 9e-43 BLAST
DWA 168 274 1.17e-51 SMART
DWB 330 492 3.62e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144323
Predicted Effect probably benign
Transcript: ENSMUST00000179458
SMART Domains Protein: ENSMUSP00000137442
Gene: ENSMUSG00000036867

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
low complexity region 50 73 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperplasia of cardiac valves, septation defects, and usually, postnatal lethality. Survivors develop aortic ossification and hypertension as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Smad6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Smad6 APN 9 63953981 missense probably damaging 1.00
IGL02419:Smad6 APN 9 63953518 utr 3 prime probably benign
IGL02511:Smad6 APN 9 63953577 missense probably damaging 1.00
R5010:Smad6 UTSW 9 63953900 missense possibly damaging 0.76
R6791:Smad6 UTSW 9 64012227 missense probably benign
R7155:Smad6 UTSW 9 64021787 missense unknown
R7205:Smad6 UTSW 9 64020406 missense probably damaging 1.00
R7573:Smad6 UTSW 9 64021770 missense unknown
R8053:Smad6 UTSW 9 64020507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCGCAGTCACTCTCAGG -3'
(R):5'- AGCTCCCTCATGTTGCAGC -3'

Sequencing Primer
(F):5'- AGTCACTCTCAGGCAGCCAG -3'
(R):5'- TTCGACGACAGGCTGTGC -3'
Posted On2015-04-30