Incidental Mutation 'R3975:Bfsp2'
List |< first << previous [record 5 of 60] next >> last >|
ID312606
Institutional Source Beutler Lab
Gene Symbol Bfsp2
Ensembl Gene ENSMUSG00000032556
Gene Namebeaded filament structural protein 2, phakinin
SynonymsCP49
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3975 (G1)
Quality Score172
Status Validated
Chromosome9
Chromosomal Location103424924-103480420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103480072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 52 (V52A)
Ref Sequence ENSEMBL: ENSMUSP00000116249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000124310] [ENSMUST00000189066] [ENSMUST00000189588]
Predicted Effect probably benign
Transcript: ENSMUST00000049452
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124310
AA Change: V52A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116249
Gene: ENSMUSG00000032556
AA Change: V52A

DomainStartEndE-ValueType
Filament 102 416 6.85e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144420
Predicted Effect probably benign
Transcript: ENSMUST00000189066
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189588
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191069
Meta Mutation Damage Score 0.1534 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations at this locus result in eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Bfsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Bfsp2 APN 9 103453098 missense possibly damaging 0.90
IGL01160:Bfsp2 APN 9 103480168 missense probably benign 0.02
R0408:Bfsp2 UTSW 9 103480100 missense probably benign 0.06
R0463:Bfsp2 UTSW 9 103426655 missense possibly damaging 0.94
R1454:Bfsp2 UTSW 9 103480225 start codon destroyed probably null 0.59
R1854:Bfsp2 UTSW 9 103449831 missense probably benign 0.01
R2139:Bfsp2 UTSW 9 103449875 missense probably benign 0.19
R2187:Bfsp2 UTSW 9 103426777 nonsense probably null
R4823:Bfsp2 UTSW 9 103479883 missense probably damaging 1.00
R5035:Bfsp2 UTSW 9 103479866 missense probably benign 0.35
R5973:Bfsp2 UTSW 9 103432657 critical splice donor site probably null
R6005:Bfsp2 UTSW 9 103448550 missense probably damaging 0.99
R6106:Bfsp2 UTSW 9 103479824 missense probably benign 0.09
R6348:Bfsp2 UTSW 9 103480072 missense probably benign 0.17
R6364:Bfsp2 UTSW 9 103448628 missense probably damaging 0.98
R6701:Bfsp2 UTSW 9 103479878 missense possibly damaging 0.68
R6736:Bfsp2 UTSW 9 103480204 missense possibly damaging 0.60
R7129:Bfsp2 UTSW 9 103479919 missense probably damaging 0.99
R7204:Bfsp2 UTSW 9 103432666 missense probably damaging 0.99
R7329:Bfsp2 UTSW 9 103449922 missense probably benign 0.01
R7453:Bfsp2 UTSW 9 103453107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAACAGTAGTGTGATCCC -3'
(R):5'- GCTCATGGAAGGCAGTAGAC -3'

Sequencing Primer
(F):5'- CAACAGTAGTGTGATCCCTTTCTGG -3'
(R):5'- TGGACCCTGTAAACCTGCCAG -3'
Posted On2015-04-30