Incidental Mutation 'R3975:Ccn6'
ID 312607
Institutional Source Beutler Lab
Gene Symbol Ccn6
Ensembl Gene ENSMUSG00000062074
Gene Name cellular communication network factor 6
Synonyms LOC327743, CCN6, Wisp3
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3975 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 39026966-39039790 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 39031094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 143 (C143S)
Ref Sequence ENSEMBL: ENSMUSP00000076003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019991] [ENSMUST00000076713] [ENSMUST00000213459]
AlphaFold D3Z5L9
Predicted Effect probably benign
Transcript: ENSMUST00000019991
SMART Domains Protein: ENSMUSP00000019991
Gene: ENSMUSG00000019845

DomainStartEndE-ValueType
Tubulin 55 277 1.08e-38 SMART
Tubulin_C 279 414 9.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076713
AA Change: C143S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076003
Gene: ENSMUSG00000062074
AA Change: C143S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IB 46 116 1.01e-15 SMART
Blast:VWC 122 179 1e-27 BLAST
TSP1 211 253 6.58e-5 SMART
CT 273 342 1.23e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213459
Meta Mutation Damage Score 0.8757 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities in size, weight, skeletal development, ossification, or the occurrence of joint disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bckdha C A 7: 25,330,858 (GRCm39) D53Y probably damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Or8k40 T A 2: 86,584,887 (GRCm39) H65L probably damaging Het
Orm3 A T 4: 63,274,395 (GRCm39) probably null Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Rara T G 11: 98,861,395 (GRCm39) I236S probably damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tap1 C A 17: 34,408,541 (GRCm39) probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Thrb A G 14: 18,033,456 (GRCm38) I406M probably damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Ccn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccn6 APN 10 39,034,306 (GRCm39) missense probably damaging 1.00
IGL02429:Ccn6 APN 10 39,030,989 (GRCm39) missense probably benign 0.03
IGL02675:Ccn6 APN 10 39,027,236 (GRCm39) missense possibly damaging 0.77
IGL03160:Ccn6 APN 10 39,029,233 (GRCm39) missense probably damaging 1.00
IGL03214:Ccn6 APN 10 39,029,163 (GRCm39) missense probably benign 0.04
R0666:Ccn6 UTSW 10 39,027,285 (GRCm39) missense probably benign 0.45
R1350:Ccn6 UTSW 10 39,034,302 (GRCm39) missense probably damaging 1.00
R1478:Ccn6 UTSW 10 39,029,239 (GRCm39) missense probably damaging 1.00
R1479:Ccn6 UTSW 10 39,029,239 (GRCm39) missense probably damaging 1.00
R1624:Ccn6 UTSW 10 39,029,239 (GRCm39) missense probably damaging 1.00
R3833:Ccn6 UTSW 10 39,030,945 (GRCm39) missense probably benign 0.00
R5051:Ccn6 UTSW 10 39,031,152 (GRCm39) missense probably benign 0.00
R6000:Ccn6 UTSW 10 39,034,296 (GRCm39) missense probably damaging 1.00
R6492:Ccn6 UTSW 10 39,030,983 (GRCm39) missense probably benign 0.01
R6775:Ccn6 UTSW 10 39,027,351 (GRCm39) missense probably damaging 0.99
R7053:Ccn6 UTSW 10 39,034,297 (GRCm39) missense probably damaging 1.00
R7138:Ccn6 UTSW 10 39,034,473 (GRCm39) missense possibly damaging 0.80
R7253:Ccn6 UTSW 10 39,031,031 (GRCm39) missense probably benign 0.04
R7367:Ccn6 UTSW 10 39,034,261 (GRCm39) missense probably damaging 1.00
R7475:Ccn6 UTSW 10 39,034,296 (GRCm39) missense probably damaging 1.00
R8417:Ccn6 UTSW 10 39,027,207 (GRCm39) nonsense probably null
R8547:Ccn6 UTSW 10 39,027,194 (GRCm39) missense probably damaging 1.00
R9781:Ccn6 UTSW 10 39,027,167 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCCCGCAACCAGTAAGTTC -3'
(R):5'- TTCTGTGAAGGAAATTCTAAAGGAGGC -3'

Sequencing Primer
(F):5'- CTACTGCCTGTGGTACATAAAATGGG -3'
(R):5'- GGAGGCTTAAGGAATTAAGAACTATG -3'
Posted On 2015-04-30