Incidental Mutation 'R3975:Wisp3'
List |< first << previous [record 59 of 60] next >> last >|
ID312607
Institutional Source Beutler Lab
Gene Symbol Wisp3
Ensembl Gene ENSMUSG00000062074
Gene NameWNT1 inducible signaling pathway protein 3
SynonymsLOC327743, CCN6
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39150970-39163794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 39155098 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 143 (C143S)
Ref Sequence ENSEMBL: ENSMUSP00000076003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019991] [ENSMUST00000076713] [ENSMUST00000213459]
Predicted Effect probably benign
Transcript: ENSMUST00000019991
SMART Domains Protein: ENSMUSP00000019991
Gene: ENSMUSG00000019845

DomainStartEndE-ValueType
Tubulin 55 277 1.08e-38 SMART
Tubulin_C 279 414 9.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076713
AA Change: C143S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076003
Gene: ENSMUSG00000062074
AA Change: C143S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IB 46 116 1.01e-15 SMART
Blast:VWC 122 179 1e-27 BLAST
TSP1 211 253 6.58e-5 SMART
CT 273 342 1.23e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213459
Meta Mutation Damage Score 0.8757 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities in size, weight, skeletal development, ossification, or the occurrence of joint disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Wisp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Wisp3 APN 10 39158310 missense probably damaging 1.00
IGL02429:Wisp3 APN 10 39154993 missense probably benign 0.03
IGL02675:Wisp3 APN 10 39151240 missense possibly damaging 0.77
IGL03160:Wisp3 APN 10 39153237 missense probably damaging 1.00
IGL03214:Wisp3 APN 10 39153167 missense probably benign 0.04
R0666:Wisp3 UTSW 10 39151289 missense probably benign 0.45
R1350:Wisp3 UTSW 10 39158306 missense probably damaging 1.00
R1478:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1479:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1624:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R3833:Wisp3 UTSW 10 39154949 missense probably benign 0.00
R5051:Wisp3 UTSW 10 39155156 missense probably benign 0.00
R6000:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
R6492:Wisp3 UTSW 10 39154987 missense probably benign 0.01
R6775:Wisp3 UTSW 10 39151355 missense probably damaging 0.99
R7053:Wisp3 UTSW 10 39158301 missense probably damaging 1.00
R7138:Wisp3 UTSW 10 39158477 missense possibly damaging 0.80
R7253:Wisp3 UTSW 10 39155035 missense probably benign 0.04
R7367:Wisp3 UTSW 10 39158265 missense probably damaging 1.00
R7475:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCGCAACCAGTAAGTTC -3'
(R):5'- TTCTGTGAAGGAAATTCTAAAGGAGGC -3'

Sequencing Primer
(F):5'- CTACTGCCTGTGGTACATAAAATGGG -3'
(R):5'- GGAGGCTTAAGGAATTAAGAACTATG -3'
Posted On2015-04-30