Mutagenetix > Incidental Mutation

Incidental Mutation 'R3975:Rara'

312608

Institutional Source

Beutler Lab

Gene Symbol

Rara

Ensembl Gene

ENSMUSG00000037992

Gene Name

retinoic acid receptor, alpha

Synonyms

RAR alpha 1, RARalpha1

MMRRC Submission

040939-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98927818-98974942 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 98970569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 236 (I236S)

Ref Sequence

ENSEMBL: ENSMUSP00000129791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068133] [ENSMUST00000107473] [ENSMUST00000107474] [ENSMUST00000107475] [ENSMUST00000164748]

AlphaFold

P11416

Predicted Effect

probably damaging
Transcript: ENSMUST00000068133
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069744
Gene: ENSMUSG00000037992
AA Change: I236S

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	65	80	N/A	INTRINSIC
ZnF_C4	85	156	7.53e-40	SMART
HOLI	230	388	1.22e-34	SMART
low complexity region	425	436	N/A	INTRINSIC
low complexity region	439	462	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107473
AA Change: I233S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103097
Gene: ENSMUSG00000037992
AA Change: I233S

Domain	Start	End	E-Value	Type
low complexity region	54	77	N/A	INTRINSIC
ZnF_C4	82	153	7.53e-40	SMART
HOLI	227	385	1.22e-34	SMART
low complexity region	422	433	N/A	INTRINSIC
low complexity region	436	459	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107474
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103098
Gene: ENSMUSG00000037992
AA Change: I236S

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	65	80	N/A	INTRINSIC
ZnF_C4	85	156	7.53e-40	SMART
HOLI	230	388	1.22e-34	SMART
low complexity region	425	436	N/A	INTRINSIC
low complexity region	439	462	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107475
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103099
Gene: ENSMUSG00000037992
AA Change: I236S

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	65	80	N/A	INTRINSIC
ZnF_C4	85	156	7.53e-40	SMART
HOLI	230	388	1.22e-34	SMART
low complexity region	425	436	N/A	INTRINSIC
low complexity region	439	462	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164748
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129791
Gene: ENSMUSG00000037992
AA Change: I236S

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	65	80	N/A	INTRINSIC
ZnF_C4	85	156	7.53e-40	SMART
HOLI	230	388	1.22e-34	SMART
low complexity region	425	436	N/A	INTRINSIC
low complexity region	439	462	N/A	INTRINSIC

Meta Mutation Damage Score

0.9682

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for targeted null mutations show high neonatal mortality due to maternal cannibalization, failure to thrive, and excess mortality during the postnatal period. Male survivors exhibit testicular degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Rara

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00951:Rara	APN	11	98968166	missense	probably benign	0.00
IGL01155:Rara	APN	11	98968184	missense	possibly damaging	0.92
IGL02141:Rara	APN	11	98968081	missense	probably damaging	1.00
IGL03194:Rara	APN	11	98971664	missense	possibly damaging	0.96
annie	UTSW	11	98973626	missense	unknown
kane	UTSW	11	98971769	missense	probably damaging	1.00
Orphan	UTSW	11	98970163	missense	probably damaging	1.00
warbucks	UTSW	11	98970569	missense	probably damaging	1.00
PIT4486001:Rara	UTSW	11	98973495	missense	possibly damaging	0.88
R0626:Rara	UTSW	11	98971580	critical splice acceptor site	probably null
R1973:Rara	UTSW	11	98971670	missense	possibly damaging	0.91
R4357:Rara	UTSW	11	98968111	missense	probably damaging	0.98
R5102:Rara	UTSW	11	98966359	missense	possibly damaging	0.80
R5147:Rara	UTSW	11	98950724	missense	probably benign	0.35
R5381:Rara	UTSW	11	98971584	missense	possibly damaging	0.93
R5570:Rara	UTSW	11	98972652	missense	probably damaging	1.00
R5861:Rara	UTSW	11	98968161	nonsense	probably null
R6273:Rara	UTSW	11	98970222	missense	probably benign	0.00
R6404:Rara	UTSW	11	98961013	missense	probably benign	0.16
R8906:Rara	UTSW	11	98970163	missense	probably damaging	1.00
R8921:Rara	UTSW	11	98973626	missense	unknown
R8978:Rara	UTSW	11	98971769	missense	probably damaging	1.00
R9224:Rara	UTSW	11	98966410	frame shift	probably null
R9476:Rara	UTSW	11	98970157	missense	probably benign	0.02
R9510:Rara	UTSW	11	98970157	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGTCAGGAAGTGTAGGCTGAGC -3'
(R):5'- AGCTAAGTGGACAAGGTGCC -3'

Sequencing Primer
(F):5'- TGTAGGCTGAGCAGAGGGC -3'
(R):5'- CATCGGGGAAAGTGGCCATC -3'

Posted On

2015-04-30