Incidental Mutation 'R3975:Rara'
ID 312608
Institutional Source Beutler Lab
Gene Symbol Rara
Ensembl Gene ENSMUSG00000037992
Gene Name retinoic acid receptor, alpha
Synonyms RARalpha1, RAR alpha 1
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3975 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 98818644-98865768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 98861395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 236 (I236S)
Ref Sequence ENSEMBL: ENSMUSP00000129791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068133] [ENSMUST00000107473] [ENSMUST00000107474] [ENSMUST00000107475] [ENSMUST00000164748]
AlphaFold P11416
Predicted Effect probably damaging
Transcript: ENSMUST00000068133
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069744
Gene: ENSMUSG00000037992
AA Change: I236S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107473
AA Change: I233S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103097
Gene: ENSMUSG00000037992
AA Change: I233S

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
ZnF_C4 82 153 7.53e-40 SMART
HOLI 227 385 1.22e-34 SMART
low complexity region 422 433 N/A INTRINSIC
low complexity region 436 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107474
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103098
Gene: ENSMUSG00000037992
AA Change: I236S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107475
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103099
Gene: ENSMUSG00000037992
AA Change: I236S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164748
AA Change: I236S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129791
Gene: ENSMUSG00000037992
AA Change: I236S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for targeted null mutations show high neonatal mortality due to maternal cannibalization, failure to thrive, and excess mortality during the postnatal period. Male survivors exhibit testicular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bckdha C A 7: 25,330,858 (GRCm39) D53Y probably damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ccn6 C G 10: 39,031,094 (GRCm39) C143S probably damaging Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Or8k40 T A 2: 86,584,887 (GRCm39) H65L probably damaging Het
Orm3 A T 4: 63,274,395 (GRCm39) probably null Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tap1 C A 17: 34,408,541 (GRCm39) probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Thrb A G 14: 18,033,456 (GRCm38) I406M probably damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Rara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Rara APN 11 98,858,992 (GRCm39) missense probably benign 0.00
IGL01155:Rara APN 11 98,859,010 (GRCm39) missense possibly damaging 0.92
IGL02141:Rara APN 11 98,858,907 (GRCm39) missense probably damaging 1.00
IGL03194:Rara APN 11 98,862,490 (GRCm39) missense possibly damaging 0.96
annie UTSW 11 98,864,452 (GRCm39) missense unknown
kane UTSW 11 98,862,595 (GRCm39) missense probably damaging 1.00
Orphan UTSW 11 98,860,989 (GRCm39) missense probably damaging 1.00
warbucks UTSW 11 98,861,395 (GRCm39) missense probably damaging 1.00
PIT4486001:Rara UTSW 11 98,864,321 (GRCm39) missense possibly damaging 0.88
R0626:Rara UTSW 11 98,862,406 (GRCm39) critical splice acceptor site probably null
R1973:Rara UTSW 11 98,862,496 (GRCm39) missense possibly damaging 0.91
R4357:Rara UTSW 11 98,858,937 (GRCm39) missense probably damaging 0.98
R5102:Rara UTSW 11 98,857,185 (GRCm39) missense possibly damaging 0.80
R5147:Rara UTSW 11 98,841,550 (GRCm39) missense probably benign 0.35
R5381:Rara UTSW 11 98,862,410 (GRCm39) missense possibly damaging 0.93
R5570:Rara UTSW 11 98,863,478 (GRCm39) missense probably damaging 1.00
R5861:Rara UTSW 11 98,858,987 (GRCm39) nonsense probably null
R6273:Rara UTSW 11 98,861,048 (GRCm39) missense probably benign 0.00
R6404:Rara UTSW 11 98,851,839 (GRCm39) missense probably benign 0.16
R8906:Rara UTSW 11 98,860,989 (GRCm39) missense probably damaging 1.00
R8921:Rara UTSW 11 98,864,452 (GRCm39) missense unknown
R8978:Rara UTSW 11 98,862,595 (GRCm39) missense probably damaging 1.00
R9224:Rara UTSW 11 98,857,236 (GRCm39) frame shift probably null
R9476:Rara UTSW 11 98,860,983 (GRCm39) missense probably benign 0.02
R9510:Rara UTSW 11 98,860,983 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTCAGGAAGTGTAGGCTGAGC -3'
(R):5'- AGCTAAGTGGACAAGGTGCC -3'

Sequencing Primer
(F):5'- TGTAGGCTGAGCAGAGGGC -3'
(R):5'- CATCGGGGAAAGTGGCCATC -3'
Posted On 2015-04-30