Incidental Mutation 'R3975:Thrb'
List |< first << previous [record 53 of 60] next >> last >|
ID312613
Institutional Source Beutler Lab
Gene Symbol Thrb
Ensembl Gene ENSMUSG00000021779
Gene Namethyroid hormone receptor beta
Synonymsc-erbAbeta, T3R[b], Nr1a2, T3Rbeta, Thrb1, TR beta, Thrb2
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location17660261-18038090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18033456 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 406 (I406M)
Ref Sequence ENSEMBL: ENSMUSP00000022304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000022304] [ENSMUST00000091471]
Predicted Effect probably damaging
Transcript: ENSMUST00000022303
AA Change: I392M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779
AA Change: I392M

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022304
AA Change: I406M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022304
Gene: ENSMUSG00000021779
AA Change: I406M

DomainStartEndE-ValueType
ZnF_C4 118 191 2.88e-36 SMART
low complexity region 202 217 N/A INTRINSIC
HOLI 288 446 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091471
AA Change: I392M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779
AA Change: I392M

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Meta Mutation Damage Score 0.6417 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Thrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Thrb APN 14 18011056 splice site probably benign
IGL02488:Thrb APN 14 18033455 missense probably damaging 0.98
IGL02598:Thrb APN 14 18008606 missense possibly damaging 0.95
IGL02707:Thrb APN 14 18026721 missense probably benign 0.42
harry UTSW 14 18011145 nonsense probably null
R0479:Thrb UTSW 14 18033643 missense probably damaging 0.99
R0988:Thrb UTSW 14 17981837 intron probably benign
R1257:Thrb UTSW 14 18008642 missense probably damaging 1.00
R1522:Thrb UTSW 14 18002597 missense probably damaging 1.00
R1927:Thrb UTSW 14 18008674 missense probably damaging 1.00
R2100:Thrb UTSW 14 18030393 missense possibly damaging 0.73
R2134:Thrb UTSW 14 18033487 missense probably benign 0.22
R3551:Thrb UTSW 14 17963214 missense probably damaging 0.99
R3888:Thrb UTSW 14 18033551 missense probably damaging 1.00
R4294:Thrb UTSW 14 18011145 nonsense probably null
R4371:Thrb UTSW 14 18030275 missense probably damaging 1.00
R4454:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4457:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4486:Thrb UTSW 14 17925640 start codon destroyed probably null 0.72
R4961:Thrb UTSW 14 18011076 missense probably benign 0.39
R5184:Thrb UTSW 14 18011181 nonsense probably null
R5609:Thrb UTSW 14 18033526 missense probably benign 0.22
R6023:Thrb UTSW 14 18011209 missense probably damaging 0.98
R6891:Thrb UTSW 14 17981899 missense probably benign
R7288:Thrb UTSW 14 18030186 missense probably damaging 1.00
R7294:Thrb UTSW 14 17826963 start gained probably benign
R7780:Thrb UTSW 14 18008608 missense possibly damaging 0.73
R8098:Thrb UTSW 14 18008645 missense probably damaging 1.00
Z1177:Thrb UTSW 14 18033433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGTCTGATACTCTACAGC -3'
(R):5'- TCGTGCTGCAGGAATGACAAG -3'

Sequencing Primer
(F):5'- GGTGTCTGATACTCTACAGCCTAAG -3'
(R):5'- TCAAATACTTCTAAGAACAGAGGCG -3'
Posted On2015-04-30