Incidental Mutation 'R3975:Thrb'
ID 312613
Institutional Source Beutler Lab
Gene Symbol Thrb
Ensembl Gene ENSMUSG00000021779
Gene Name thyroid hormone receptor beta
Synonyms T3R[b], TR beta, c-erbAbeta, Nr1a2, Thrb1, Thrb2, T3Rbeta
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.623) question?
Stock # R3975 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 4431611-4809435 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18033456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 406 (I406M)
Ref Sequence ENSEMBL: ENSMUSP00000022304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000022304] [ENSMUST00000091471]
AlphaFold P37242
Predicted Effect probably damaging
Transcript: ENSMUST00000022303
AA Change: I392M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779
AA Change: I392M

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022304
AA Change: I406M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022304
Gene: ENSMUSG00000021779
AA Change: I406M

DomainStartEndE-ValueType
ZnF_C4 118 191 2.88e-36 SMART
low complexity region 202 217 N/A INTRINSIC
HOLI 288 446 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091471
AA Change: I392M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779
AA Change: I392M

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Meta Mutation Damage Score 0.6417 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bckdha C A 7: 25,330,858 (GRCm39) D53Y probably damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ccn6 C G 10: 39,031,094 (GRCm39) C143S probably damaging Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Or8k40 T A 2: 86,584,887 (GRCm39) H65L probably damaging Het
Orm3 A T 4: 63,274,395 (GRCm39) probably null Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Rara T G 11: 98,861,395 (GRCm39) I236S probably damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tap1 C A 17: 34,408,541 (GRCm39) probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Thrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Thrb APN 14 18,011,056 (GRCm38) splice site probably benign
IGL02488:Thrb APN 14 18,033,455 (GRCm38) missense probably damaging 0.98
IGL02598:Thrb APN 14 18,008,606 (GRCm38) missense possibly damaging 0.95
IGL02707:Thrb APN 14 18,026,721 (GRCm38) missense probably benign 0.42
harry UTSW 14 18,011,145 (GRCm38) nonsense probably null
R0479:Thrb UTSW 14 18,033,643 (GRCm38) missense probably damaging 0.99
R0988:Thrb UTSW 14 17,981,837 (GRCm38) intron probably benign
R1257:Thrb UTSW 14 18,008,642 (GRCm38) missense probably damaging 1.00
R1522:Thrb UTSW 14 18,002,597 (GRCm38) missense probably damaging 1.00
R1927:Thrb UTSW 14 18,008,674 (GRCm38) missense probably damaging 1.00
R2100:Thrb UTSW 14 18,030,393 (GRCm38) missense possibly damaging 0.73
R2134:Thrb UTSW 14 18,033,487 (GRCm38) missense probably benign 0.22
R3551:Thrb UTSW 14 17,963,214 (GRCm38) missense probably damaging 0.99
R3888:Thrb UTSW 14 18,033,551 (GRCm38) missense probably damaging 1.00
R4294:Thrb UTSW 14 18,011,145 (GRCm38) nonsense probably null
R4371:Thrb UTSW 14 18,030,275 (GRCm38) missense probably damaging 1.00
R4454:Thrb UTSW 14 18,011,187 (GRCm38) missense probably damaging 0.97
R4457:Thrb UTSW 14 18,011,187 (GRCm38) missense probably damaging 0.97
R4486:Thrb UTSW 14 17,925,640 (GRCm38) start codon destroyed probably null 0.72
R4961:Thrb UTSW 14 18,011,076 (GRCm38) missense probably benign 0.39
R5184:Thrb UTSW 14 18,011,181 (GRCm38) nonsense probably null
R5609:Thrb UTSW 14 18,033,526 (GRCm38) missense probably benign 0.22
R6023:Thrb UTSW 14 18,011,209 (GRCm38) missense probably damaging 0.98
R6891:Thrb UTSW 14 17,981,899 (GRCm38) missense probably benign
R7288:Thrb UTSW 14 18,030,186 (GRCm38) missense probably damaging 1.00
R7294:Thrb UTSW 14 17,826,963 (GRCm38) start gained probably benign
R7780:Thrb UTSW 14 18,008,608 (GRCm38) missense possibly damaging 0.73
R8098:Thrb UTSW 14 18,008,645 (GRCm38) missense probably damaging 1.00
R8739:Thrb UTSW 14 17,963,082 (GRCm38) missense probably benign 0.04
R8788:Thrb UTSW 14 18,002,558 (GRCm38) missense probably damaging 1.00
R8978:Thrb UTSW 14 17,981,886 (GRCm38) missense possibly damaging 0.84
R9314:Thrb UTSW 14 17,963,208 (GRCm38) missense probably benign
Z1177:Thrb UTSW 14 18,033,433 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGTCTGATACTCTACAGC -3'
(R):5'- TCGTGCTGCAGGAATGACAAG -3'

Sequencing Primer
(F):5'- GGTGTCTGATACTCTACAGCCTAAG -3'
(R):5'- TCAAATACTTCTAAGAACAGAGGCG -3'
Posted On 2015-04-30