Incidental Mutation 'R3975:Gdf2'
List |< first << previous [record 19 of 60] next >> last >|
ID312615
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Namegrowth differentiation factor 2
SynonymsBmp9
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33941039-33947198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33944834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 171 (V171D)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720]
PDB Structure
Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000100720
AA Change: V171D

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: V171D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0739:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33945241 missense probably benign
R2292:Gdf2 UTSW 14 33945188 missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3974:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3976:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33945451 missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33944906 missense probably benign 0.02
R5227:Gdf2 UTSW 14 33941494 critical splice donor site probably null
R5253:Gdf2 UTSW 14 33945307 missense probably benign 0.14
R5259:Gdf2 UTSW 14 33944831 missense probably benign 0.01
R6286:Gdf2 UTSW 14 33945100 missense probably damaging 1.00
R7644:Gdf2 UTSW 14 33944890 missense probably benign 0.00
Z1177:Gdf2 UTSW 14 33945317 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCTATATCGACAGCTGCCAC -3'
(R):5'- TTTGGAACCTGGAGGGACAC -3'

Sequencing Primer
(F):5'- CGGAGGACTTCCCCTTTCAGAAG -3'
(R):5'- ATGTCCAGTGTGTCACAGC -3'
Posted On2015-04-30