Incidental Mutation 'R3975:Tap1'
ID 312619
Institutional Source Beutler Lab
Gene Symbol Tap1
Ensembl Gene ENSMUSG00000037321
Gene Name transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms TAP, Ham1, RING4, MTP1, Tap-1, Ham-1, Abcb2, PSF-1
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3975 (G1)
Quality Score 164
Status Validated
Chromosome 17
Chromosomal Location 34406530-34416199 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 34408541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000173831] [ENSMUST00000174576]
AlphaFold P21958
Predicted Effect probably benign
Transcript: ENSMUST00000041633
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect probably benign
Transcript: ENSMUST00000170086
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171148
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173831
SMART Domains Protein: ENSMUSP00000134120
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 1 64 2.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179593
Predicted Effect probably benign
Transcript: ENSMUST00000174576
SMART Domains Protein: ENSMUSP00000133499
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 17 198 1.2e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Allele List at MGI
All alleles(2) : Targeted, knock-out(2)
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bckdha C A 7: 25,330,858 (GRCm39) D53Y probably damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ccn6 C G 10: 39,031,094 (GRCm39) C143S probably damaging Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Or8k40 T A 2: 86,584,887 (GRCm39) H65L probably damaging Het
Orm3 A T 4: 63,274,395 (GRCm39) probably null Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Rara T G 11: 98,861,395 (GRCm39) I236S probably damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Thrb A G 14: 18,033,456 (GRCm38) I406M probably damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Tap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34,413,914 (GRCm39) missense probably damaging 1.00
IGL01294:Tap1 APN 17 34,413,019 (GRCm39) critical splice donor site probably null
IGL01776:Tap1 APN 17 34,412,102 (GRCm39) missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34,415,578 (GRCm39) missense probably benign 0.21
IGL02246:Tap1 APN 17 34,412,963 (GRCm39) missense probably benign 0.01
IGL02996:Tap1 APN 17 34,410,370 (GRCm39) missense probably damaging 1.00
IGL03278:Tap1 APN 17 34,410,457 (GRCm39) missense probably damaging 1.00
bullus UTSW 17 34,408,536 (GRCm39) critical splice donor site probably null
entertainer UTSW 17 34,412,293 (GRCm39) splice site probably null
joplin UTSW 17 34,412,232 (GRCm39) missense probably damaging 1.00
ragtime UTSW 17 34,409,616 (GRCm39) nonsense probably null
rose2 UTSW 17 34,413,915 (GRCm39) missense probably damaging 1.00
Tapestry UTSW 17 34,412,163 (GRCm39) missense probably damaging 1.00
PIT4802001:Tap1 UTSW 17 34,412,165 (GRCm39) missense probably damaging 1.00
R1566:Tap1 UTSW 17 34,408,520 (GRCm39) missense probably benign 0.00
R1795:Tap1 UTSW 17 34,413,899 (GRCm39) missense probably benign 0.21
R1837:Tap1 UTSW 17 34,407,083 (GRCm39) missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34,407,083 (GRCm39) missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34,413,915 (GRCm39) missense probably damaging 1.00
R1893:Tap1 UTSW 17 34,413,915 (GRCm39) missense probably damaging 1.00
R1952:Tap1 UTSW 17 34,412,481 (GRCm39) missense probably damaging 1.00
R2163:Tap1 UTSW 17 34,408,447 (GRCm39) splice site probably null
R3744:Tap1 UTSW 17 34,412,586 (GRCm39) missense probably damaging 1.00
R3883:Tap1 UTSW 17 34,412,232 (GRCm39) missense probably damaging 1.00
R4418:Tap1 UTSW 17 34,407,353 (GRCm39) splice site probably null
R4779:Tap1 UTSW 17 34,412,865 (GRCm39) missense probably damaging 1.00
R4913:Tap1 UTSW 17 34,412,468 (GRCm39) missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34,411,868 (GRCm39) nonsense probably null
R5838:Tap1 UTSW 17 34,412,279 (GRCm39) nonsense probably null
R6248:Tap1 UTSW 17 34,412,151 (GRCm39) missense probably damaging 0.99
R6710:Tap1 UTSW 17 34,407,083 (GRCm39) missense possibly damaging 0.50
R6881:Tap1 UTSW 17 34,407,008 (GRCm39) missense probably damaging 0.99
R7437:Tap1 UTSW 17 34,409,616 (GRCm39) nonsense probably null
R7514:Tap1 UTSW 17 34,415,639 (GRCm39) missense probably damaging 1.00
R7618:Tap1 UTSW 17 34,407,212 (GRCm39) missense possibly damaging 0.94
R7968:Tap1 UTSW 17 34,413,886 (GRCm39) missense probably damaging 0.99
R8115:Tap1 UTSW 17 34,412,293 (GRCm39) splice site probably null
R8146:Tap1 UTSW 17 34,408,206 (GRCm39) missense probably damaging 0.98
R8322:Tap1 UTSW 17 34,412,163 (GRCm39) missense probably damaging 1.00
R8539:Tap1 UTSW 17 34,408,409 (GRCm39) missense probably benign
R8751:Tap1 UTSW 17 34,412,133 (GRCm39) missense probably benign 0.14
R8883:Tap1 UTSW 17 34,406,867 (GRCm39) missense unknown
R8885:Tap1 UTSW 17 34,408,536 (GRCm39) critical splice donor site probably null
R9191:Tap1 UTSW 17 34,413,956 (GRCm39) critical splice donor site probably null
R9232:Tap1 UTSW 17 34,412,277 (GRCm39) missense probably benign 0.00
R9604:Tap1 UTSW 17 34,412,172 (GRCm39) missense probably damaging 0.99
R9656:Tap1 UTSW 17 34,412,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTGATCCTCCCGTGTC -3'
(R):5'- CTGCTTCATATGGGGAACAATG -3'

Sequencing Primer
(F):5'- GTGTCTCTGACTCTAGCACAGCG -3'
(R):5'- CCCCATCCATATGGTTCTG -3'
Posted On 2015-04-30