Incidental Mutation 'R3975:Olfr134'
List |< first << previous [record 30 of 60] next >> last >|
ID312620
Institutional Source Beutler Lab
Gene Symbol Olfr134
Ensembl Gene ENSMUSG00000096009
Gene Nameolfactory receptor 134
SynonymsMOR256-5, GA_x6K02T2PSCP-2623613-2624551
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38171388-38176578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38175495 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 137 (N137S)
Ref Sequence ENSEMBL: ENSMUSP00000151069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074883] [ENSMUST00000215900]
Predicted Effect probably benign
Transcript: ENSMUST00000074883
AA Change: N137S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074423
Gene: ENSMUSG00000096009
AA Change: N137S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-50 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215900
AA Change: N137S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Olfr134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Olfr134 APN 17 38175875 missense probably damaging 1.00
IGL01749:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01750:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01751:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01753:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01757:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01765:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01766:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01767:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01822:Olfr134 APN 17 38175448 missense probably damaging 1.00
IGL02256:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02257:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02258:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02259:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02275:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02293:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02295:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02317:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02318:Olfr134 APN 17 38175686 missense probably benign 0.04
R0230:Olfr134 UTSW 17 38175950 missense probably damaging 1.00
R0363:Olfr134 UTSW 17 38175447 missense probably damaging 1.00
R1074:Olfr134 UTSW 17 38175440 missense probably damaging 1.00
R1506:Olfr134 UTSW 17 38175200 missense probably benign
R2300:Olfr134 UTSW 17 38175550 nonsense probably null
R3743:Olfr134 UTSW 17 38175902 missense probably damaging 1.00
R4230:Olfr134 UTSW 17 38175881 missense possibly damaging 0.67
R5158:Olfr134 UTSW 17 38175454 nonsense probably null
R5439:Olfr134 UTSW 17 38176026 splice site probably null
R6144:Olfr134 UTSW 17 38175225 missense probably damaging 1.00
R6309:Olfr134 UTSW 17 38175519 missense probably benign 0.00
R6675:Olfr134 UTSW 17 38176014 missense probably benign
R6800:Olfr134 UTSW 17 38175122 missense probably benign 0.01
R6873:Olfr134 UTSW 17 38175368 missense probably benign
R7193:Olfr134 UTSW 17 38175096 missense probably benign 0.44
R7534:Olfr134 UTSW 17 38175297 missense probably benign 0.22
R7869:Olfr134 UTSW 17 38175939 missense possibly damaging 0.94
R7912:Olfr134 UTSW 17 38175267 missense probably damaging 0.99
R8048:Olfr134 UTSW 17 38175528 missense probably benign 0.11
R8305:Olfr134 UTSW 17 38175573 missense probably damaging 1.00
X0011:Olfr134 UTSW 17 38175851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGACATGTGCTACACCAC -3'
(R):5'- ACCACTGAGAGAGCAAGCTC -3'

Sequencing Primer
(F):5'- GCATTGTACCTCAGATGCTAAC -3'
(R):5'- CTGAGAGAGCAAGCTCATTAGTCTC -3'
Posted On2015-04-30