Incidental Mutation 'R3975:Prdm6'
ID 312622
Institutional Source Beutler Lab
Gene Symbol Prdm6
Ensembl Gene ENSMUSG00000069378
Gene Name PR domain containing 6
Synonyms LOC225518, PRISM
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.843) question?
Stock # R3975 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 53597027-53708976 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53673278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 186 (I186T)
Ref Sequence ENSEMBL: ENSMUSP00000114644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091900] [ENSMUST00000115399] [ENSMUST00000154557]
AlphaFold Q3UZD5
Predicted Effect possibly damaging
Transcript: ENSMUST00000091900
AA Change: I347T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089513
Gene: ENSMUSG00000069378
AA Change: I347T

DomainStartEndE-ValueType
low complexity region 26 73 N/A INTRINSIC
low complexity region 77 113 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
low complexity region 229 236 N/A INTRINSIC
SET 249 372 1.98e-3 SMART
ZnF_C2H2 474 494 1.24e2 SMART
ZnF_C2H2 502 524 1.58e-3 SMART
ZnF_C2H2 530 552 1.47e-3 SMART
ZnF_C2H2 558 578 1.2e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115399
AA Change: I146T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111057
Gene: ENSMUSG00000069378
AA Change: I146T

DomainStartEndE-ValueType
low complexity region 28 35 N/A INTRINSIC
SET 48 171 1.98e-3 SMART
ZnF_C2H2 273 293 1.24e2 SMART
ZnF_C2H2 301 323 1.58e-3 SMART
ZnF_C2H2 329 351 1.47e-3 SMART
ZnF_C2H2 357 377 1.2e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154557
AA Change: I186T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114644
Gene: ENSMUSG00000069378
AA Change: I186T

DomainStartEndE-ValueType
low complexity region 68 75 N/A INTRINSIC
SET 88 211 1.98e-3 SMART
ZnF_C2H2 313 333 1.24e2 SMART
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 417 1.2e1 SMART
Meta Mutation Damage Score 0.6433 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiovascular development defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bckdha C A 7: 25,330,858 (GRCm39) D53Y probably damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ccn6 C G 10: 39,031,094 (GRCm39) C143S probably damaging Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Or8k40 T A 2: 86,584,887 (GRCm39) H65L probably damaging Het
Orm3 A T 4: 63,274,395 (GRCm39) probably null Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Rara T G 11: 98,861,395 (GRCm39) I236S probably damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tap1 C A 17: 34,408,541 (GRCm39) probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Thrb A G 14: 18,033,456 (GRCm38) I406M probably damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Prdm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Prdm6 APN 18 53,673,357 (GRCm39) missense probably benign 0.08
IGL00743:Prdm6 APN 18 53,673,300 (GRCm39) missense possibly damaging 0.84
IGL02183:Prdm6 APN 18 53,597,749 (GRCm39) unclassified probably benign
R1720:Prdm6 UTSW 18 53,673,272 (GRCm39) missense probably benign 0.29
R1879:Prdm6 UTSW 18 53,701,289 (GRCm39) missense probably damaging 1.00
R1950:Prdm6 UTSW 18 53,669,796 (GRCm39) missense possibly damaging 0.90
R1962:Prdm6 UTSW 18 53,701,233 (GRCm39) missense probably damaging 1.00
R2022:Prdm6 UTSW 18 53,598,031 (GRCm39) unclassified probably benign
R3973:Prdm6 UTSW 18 53,673,278 (GRCm39) missense possibly damaging 0.94
R3974:Prdm6 UTSW 18 53,673,278 (GRCm39) missense possibly damaging 0.94
R3976:Prdm6 UTSW 18 53,673,278 (GRCm39) missense possibly damaging 0.94
R4012:Prdm6 UTSW 18 53,673,390 (GRCm39) missense possibly damaging 0.70
R5144:Prdm6 UTSW 18 53,598,110 (GRCm39) unclassified probably benign
R5640:Prdm6 UTSW 18 53,669,813 (GRCm39) critical splice donor site probably null
R6113:Prdm6 UTSW 18 53,606,673 (GRCm39) missense probably damaging 1.00
R6701:Prdm6 UTSW 18 53,669,751 (GRCm39) missense possibly damaging 0.93
R6747:Prdm6 UTSW 18 53,598,118 (GRCm39) unclassified probably benign
R6784:Prdm6 UTSW 18 53,669,698 (GRCm39) missense probably benign 0.04
R7363:Prdm6 UTSW 18 53,598,199 (GRCm39) missense possibly damaging 0.75
R8365:Prdm6 UTSW 18 53,685,137 (GRCm39) missense probably benign 0.22
R8469:Prdm6 UTSW 18 53,597,758 (GRCm39) unclassified probably benign
R8827:Prdm6 UTSW 18 53,701,267 (GRCm39) missense probably damaging 0.99
R8977:Prdm6 UTSW 18 53,701,373 (GRCm39) missense probably damaging 0.99
R9132:Prdm6 UTSW 18 53,598,019 (GRCm39) missense unknown
R9159:Prdm6 UTSW 18 53,598,019 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTTACCATGCCGAGTTAGAGG -3'
(R):5'- TGTGGTAGAATGACCCATGC -3'

Sequencing Primer
(F):5'- CCGAGTTAGAGGCTCTCTTCAATTG -3'
(R):5'- TGGTAGAATGACCCATGCATGTC -3'
Posted On 2015-04-30