Incidental Mutation 'R3976:Olfr1306'
ID312624
Institutional Source Beutler Lab
Gene Symbol Olfr1306
Ensembl Gene ENSMUSG00000096566
Gene Nameolfactory receptor 1306
SynonymsGA_x6K02T2Q125-72954873-72953935, MOR245-15
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R3976 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111911264-111916271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111912606 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 108 (G108D)
Ref Sequence ENSEMBL: ENSMUSP00000151142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099607] [ENSMUST00000214844]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099607
AA Change: G108D

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097202
Gene: ENSMUSG00000096566
AA Change: G108D

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 4.7e-43 PFAM
Pfam:7tm_1 41 287 9.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214844
AA Change: G108D

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Asb4 A T 6: 5,390,771 M55L probably benign Het
Atxn7l1 T C 12: 33,325,955 S10P probably damaging Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Suox A G 10: 128,671,037 V374A probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Olfr1306
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1306 APN 2 111912036 missense possibly damaging 0.95
IGL01310:Olfr1306 APN 2 111912307 missense probably benign 0.34
IGL01893:Olfr1306 APN 2 111912244 missense possibly damaging 0.65
IGL02433:Olfr1306 APN 2 111912417 missense probably damaging 1.00
IGL03302:Olfr1306 APN 2 111912822 missense possibly damaging 0.61
R0544:Olfr1306 UTSW 2 111912560 nonsense probably null
R0674:Olfr1306 UTSW 2 111912673 missense probably benign 0.41
R1118:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R1764:Olfr1306 UTSW 2 111912181 missense possibly damaging 0.93
R2915:Olfr1306 UTSW 2 111912719 missense probably damaging 1.00
R4855:Olfr1306 UTSW 2 111912099 missense probably benign 0.41
R6475:Olfr1306 UTSW 2 111912859 nonsense probably null
R6513:Olfr1306 UTSW 2 111912883 missense possibly damaging 0.89
R6536:Olfr1306 UTSW 2 111912774 missense possibly damaging 0.94
R6748:Olfr1306 UTSW 2 111912357 missense possibly damaging 0.47
R6843:Olfr1306 UTSW 2 111912915 missense probably damaging 1.00
R7006:Olfr1306 UTSW 2 111912256 missense probably benign 0.16
R7169:Olfr1306 UTSW 2 111912594 missense possibly damaging 0.95
R7230:Olfr1306 UTSW 2 111912561 missense probably damaging 1.00
R7419:Olfr1306 UTSW 2 111912090 missense probably damaging 1.00
R7448:Olfr1306 UTSW 2 111912292 missense probably benign 0.00
R7753:Olfr1306 UTSW 2 111912582 missense probably benign 0.06
R7761:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R8330:Olfr1306 UTSW 2 111912379 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCACAGTAGAAGCTGTCCAAC -3'
(R):5'- TTCACTGTGGCATCTGACCC -3'

Sequencing Primer
(F):5'- CAGTAGAAGCTGTCCAACACATTTG -3'
(R):5'- GTGGCATCTGACCCTCACTTAC -3'
Posted On2015-04-30