Incidental Mutation 'R3976:Bola3'
ID312637
Institutional Source Beutler Lab
Gene Symbol Bola3
Ensembl Gene ENSMUSG00000045160
Gene NamebolA-like 3 (E. coli)
Synonyms
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3976 (G1)
Quality Score211
Status Validated
Chromosome6
Chromosomal Location83349147-83360136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83351267 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 45 (L45P)
Ref Sequence ENSEMBL: ENSMUSP00000112582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120040] [ENSMUST00000122216] [ENSMUST00000136501]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055875
Predicted Effect probably benign
Transcript: ENSMUST00000120040
AA Change: L45P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112582
Gene: ENSMUSG00000045160
AA Change: L45P

DomainStartEndE-ValueType
Pfam:BolA 60 135 4.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122216
AA Change: L4P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113439
Gene: ENSMUSG00000045160
AA Change: L4P

DomainStartEndE-ValueType
Pfam:BolA 26 94 7.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134765
Predicted Effect probably benign
Transcript: ENSMUST00000136501
AA Change: L19P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118348
Gene: ENSMUSG00000045160
AA Change: L19P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:BolA 41 109 4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151329
Meta Mutation Damage Score 0.1588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an essential role in the production of iron-sulfur (Fe-S) clusters for the normal maturation of lipoate-containing 2-oxoacid dehydrogenases, and for the assembly of the mitochondrial respiratory chain complexes. Mutation in this gene has been associated with multiple mitochondrial dysfunctions syndrome-2. Two alternatively spliced transcript variants encoding different isoforms with distinct subcellular localization have been reported for this gene (PMID:21944046). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Asb4 A T 6: 5,390,771 M55L probably benign Het
Atxn7l1 T C 12: 33,325,955 S10P probably damaging Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1306 C T 2: 111,912,606 G108D possibly damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Suox A G 10: 128,671,037 V374A probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Bola3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2967:Bola3 UTSW 6 83349298 missense probably benign 0.00
R3975:Bola3 UTSW 6 83351267 missense probably benign 0.03
R5425:Bola3 UTSW 6 83349552 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTAGGTAGTGAGCGCC -3'
(R):5'- AGTCATTGGGTCAAGTGCCC -3'

Sequencing Primer
(F):5'- CCTGCTCTGGCCCTTCAGG -3'
(R):5'- GGTCAAGTGCCCTCCTCATG -3'
Posted On2015-04-30