Incidental Mutation 'R3976:Suox'
ID312646
Institutional Source Beutler Lab
Gene Symbol Suox
Ensembl Gene ENSMUSG00000049858
Gene Namesulfite oxidase
Synonyms
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R3976 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128669894-128674073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128671037 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 374 (V374A)
Ref Sequence ENSEMBL: ENSMUSP00000056195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054764]
Predicted Effect probably damaging
Transcript: ENSMUST00000054764
AA Change: V374A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056195
Gene: ENSMUSG00000049858
AA Change: V374A

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Cyt-b5 86 162 3.41e-13 SMART
Pfam:Oxidored_molyb 220 396 1.2e-62 PFAM
Pfam:Mo-co_dimer 418 545 1.7e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217817
Meta Mutation Damage Score 0.3559 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Asb4 A T 6: 5,390,771 M55L probably benign Het
Atxn7l1 T C 12: 33,325,955 S10P probably damaging Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1306 C T 2: 111,912,606 G108D possibly damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Suox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Suox APN 10 128672098 splice site probably benign
IGL02744:Suox APN 10 128671217 missense probably benign 0.00
PIT4402001:Suox UTSW 10 128671295 missense probably damaging 1.00
R0414:Suox UTSW 10 128671457 missense probably benign 0.01
R0418:Suox UTSW 10 128670885 missense probably damaging 1.00
R0612:Suox UTSW 10 128670656 missense probably benign
R1845:Suox UTSW 10 128670539 missense possibly damaging 0.56
R4808:Suox UTSW 10 128671889 missense possibly damaging 0.81
R5098:Suox UTSW 10 128671158 missense probably damaging 1.00
R5587:Suox UTSW 10 128671825 missense probably damaging 1.00
R5721:Suox UTSW 10 128671293 missense possibly damaging 0.55
R6968:Suox UTSW 10 128671833 missense possibly damaging 0.92
R7378:Suox UTSW 10 128671041 missense probably benign 0.05
R7669:Suox UTSW 10 128670911 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGATAGTCACCTCGCCTG -3'
(R):5'- AGGCCCATGTCTGTTTTGAAG -3'

Sequencing Primer
(F):5'- TACAATGGCCCCATCTTGAGG -3'
(R):5'- GGACTGGATTCAGACCCCACTG -3'
Posted On2015-04-30