Incidental Mutation 'R3976:Atxn7l1'
ID312649
Institutional Source Beutler Lab
Gene Symbol Atxn7l1
Ensembl Gene ENSMUSG00000020564
Gene Nameataxin 7-like 1
SynonymsAtxn7l4, 2810423G08Rik
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R3976 (G1)
Quality Score210
Status Validated
Chromosome12
Chromosomal Location33147693-33373185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33325955 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 10 (S10P)
Ref Sequence ENSEMBL: ENSMUSP00000122982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000136644] [ENSMUST00000144586] [ENSMUST00000146040] [ENSMUST00000154742]
Predicted Effect probably damaging
Transcript: ENSMUST00000090597
AA Change: S10P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564
AA Change: S10P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 143 220 2.5e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125192
AA Change: S106P

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564
AA Change: S106P

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 567 597 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 792 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133549
SMART Domains Protein: ENSMUSP00000120569
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136644
AA Change: S83P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect silent
Transcript: ENSMUST00000144586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145589
Predicted Effect probably benign
Transcript: ENSMUST00000146040
AA Change: S106P

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564
AA Change: S106P

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2.3e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 578 590 N/A INTRINSIC
low complexity region 669 699 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 894 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154742
AA Change: S10P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564
AA Change: S10P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 150 218 1.3e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155386
SMART Domains Protein: ENSMUSP00000115463
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Asb4 A T 6: 5,390,771 M55L probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1306 C T 2: 111,912,606 G108D possibly damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Suox A G 10: 128,671,037 V374A probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Atxn7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Atxn7l1 APN 12 33342142 missense probably damaging 1.00
IGL02146:Atxn7l1 APN 12 33368031 missense probably benign
IGL02202:Atxn7l1 APN 12 33342078 missense probably benign 0.05
IGL02804:Atxn7l1 APN 12 33367789 missense probably damaging 1.00
IGL03344:Atxn7l1 APN 12 33326066 missense probably damaging 1.00
R0270:Atxn7l1 UTSW 12 33342151 missense possibly damaging 0.58
R0621:Atxn7l1 UTSW 12 33326100 missense probably benign 0.15
R1840:Atxn7l1 UTSW 12 33371033 unclassified probably null
R1856:Atxn7l1 UTSW 12 33358770 missense probably damaging 1.00
R1992:Atxn7l1 UTSW 12 33358744 missense probably damaging 1.00
R1993:Atxn7l1 UTSW 12 33345977 missense probably benign
R2249:Atxn7l1 UTSW 12 33358840 missense probably damaging 1.00
R2369:Atxn7l1 UTSW 12 33358850 critical splice donor site probably null
R3695:Atxn7l1 UTSW 12 33358697 missense probably damaging 1.00
R3856:Atxn7l1 UTSW 12 33367600 missense probably damaging 1.00
R4151:Atxn7l1 UTSW 12 33364482 missense probably damaging 0.96
R4301:Atxn7l1 UTSW 12 33367238 missense probably damaging 1.00
R4305:Atxn7l1 UTSW 12 33341992 missense probably damaging 0.99
R4411:Atxn7l1 UTSW 12 33194887 intron probably benign
R4763:Atxn7l1 UTSW 12 33358878 intron probably benign
R5049:Atxn7l1 UTSW 12 33358687 missense probably benign 0.00
R5090:Atxn7l1 UTSW 12 33326078 missense probably damaging 1.00
R5134:Atxn7l1 UTSW 12 33372876 missense probably damaging 1.00
R5425:Atxn7l1 UTSW 12 33367120 missense probably damaging 1.00
R6161:Atxn7l1 UTSW 12 33358663 missense possibly damaging 0.62
R6813:Atxn7l1 UTSW 12 33367124 missense probably damaging 0.96
R7248:Atxn7l1 UTSW 12 33367195 missense probably benign 0.26
R7328:Atxn7l1 UTSW 12 33148503 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAAGTTGGCACTGACGGC -3'
(R):5'- TGGACTCACCATGGTTTATCC -3'

Sequencing Primer
(F):5'- TGACGGCCAACATCAGAGC -3'
(R):5'- CCTTGGTCCCTTTGCAGAGAAG -3'
Posted On2015-04-30