Incidental Mutation 'R3976:Gdf2'
ID 312656
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Name growth differentiation factor 2
Synonyms Bmp9
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3976 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 33941039-33947198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33944834 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 171 (V171D)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720]
AlphaFold Q9WV56
PDB Structure Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000100720
AA Change: V171D

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: V171D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Asb4 A T 6: 5,390,771 M55L probably benign Het
Atxn7l1 T C 12: 33,325,955 S10P probably damaging Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1306 C T 2: 111,912,606 G108D possibly damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Suox A G 10: 128,671,037 V374A probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0739:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33945241 missense probably benign
R2292:Gdf2 UTSW 14 33945188 missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3974:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3975:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33945451 missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33944906 missense probably benign 0.02
R5227:Gdf2 UTSW 14 33941494 critical splice donor site probably null
R5253:Gdf2 UTSW 14 33945307 missense probably benign 0.14
R5259:Gdf2 UTSW 14 33944831 missense probably benign 0.01
R6286:Gdf2 UTSW 14 33945100 missense probably damaging 1.00
R7644:Gdf2 UTSW 14 33944890 missense probably benign 0.00
R8472:Gdf2 UTSW 14 33944840 missense probably damaging 1.00
R9067:Gdf2 UTSW 14 33941454 missense probably benign 0.20
Z1177:Gdf2 UTSW 14 33945317 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCAGATGCTATATCGACAGCTG -3'
(R):5'- AACCTGGAGGGACACTGATG -3'

Sequencing Primer
(F):5'- TATATCGACAGCTGCCACGGAG -3'
(R):5'- ATGTCCAGTGTGTCACAGC -3'
Posted On 2015-04-30