Incidental Mutation 'R4019:Olfr1211'
ID312673
Institutional Source Beutler Lab
Gene Symbol Olfr1211
Ensembl Gene ENSMUSG00000075112
Gene Nameolfactory receptor 1211
SynonymsMOR233-21, MOR233-16P, GA_x6K02T2Q125-50409367-50408432
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4019 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88926876-88938111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88929736 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 193 (I193T)
Ref Sequence ENSEMBL: ENSMUSP00000150571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099808] [ENSMUST00000213412] [ENSMUST00000215205]
Predicted Effect probably benign
Transcript: ENSMUST00000099808
AA Change: I193T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097396
Gene: ENSMUSG00000075112
AA Change: I193T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.5e-49 PFAM
Pfam:7tm_1 39 286 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141958
Predicted Effect probably benign
Transcript: ENSMUST00000213412
AA Change: I193T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215205
AA Change: I193T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Olfr1211
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Olfr1211 APN 2 88929448 missense probably damaging 1.00
IGL02936:Olfr1211 APN 2 88929784 missense probably benign 0.01
IGL02960:Olfr1211 APN 2 88929784 missense possibly damaging 0.80
IGL02989:Olfr1211 APN 2 88929704 missense possibly damaging 0.72
R0193:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R0413:Olfr1211 UTSW 2 88929562 missense probably benign 0.16
R1644:Olfr1211 UTSW 2 88929387 missense probably benign 0.01
R3715:Olfr1211 UTSW 2 88929413 missense probably benign 0.07
R4722:Olfr1211 UTSW 2 88929980 missense possibly damaging 0.91
R4751:Olfr1211 UTSW 2 88929914 missense probably damaging 1.00
R4859:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R5053:Olfr1211 UTSW 2 88930253 missense probably benign 0.02
R6148:Olfr1211 UTSW 2 88930253 missense probably benign 0.00
R7064:Olfr1211 UTSW 2 88929509 missense probably benign 0.00
R7527:Olfr1211 UTSW 2 88930090 missense probably benign 0.00
R7584:Olfr1211 UTSW 2 88929805 missense probably damaging 1.00
R7989:Olfr1211 UTSW 2 88929514 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCCACCATTTTATCAAAGGAG -3'
(R):5'- ATGAACTGGAGGCTCTGTGG -3'

Sequencing Primer
(F):5'- CACCATTTTATCAAAGGAGAAAGCAG -3'
(R):5'- TGGCACACTTATGGGGATAGC -3'
Posted On2015-04-30