Incidental Mutation 'R4019:Zfp335'
ID 312676
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Name zinc finger protein 335
Synonyms 1810045J01Rik
MMRRC Submission 040953-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4019 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 164891882-164911757 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 164901460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 536 (R536H)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
AlphaFold A2A5K6
Predicted Effect probably damaging
Transcript: ENSMUST00000041361
AA Change: R536H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: R536H

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183830
AA Change: R536H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834
AA Change: R536H

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
R7174:Zfp335 UTSW 2 164902503 missense probably damaging 1.00
R7185:Zfp335 UTSW 2 164893244 critical splice donor site probably null
R7296:Zfp335 UTSW 2 164900132 missense probably damaging 0.99
R7322:Zfp335 UTSW 2 164910821 start codon destroyed probably null 0.90
R7504:Zfp335 UTSW 2 164909418 missense probably benign 0.27
R7560:Zfp335 UTSW 2 164895992 missense probably damaging 1.00
R7637:Zfp335 UTSW 2 164892539 critical splice donor site probably null
R8064:Zfp335 UTSW 2 164907700 missense probably damaging 1.00
R8208:Zfp335 UTSW 2 164893616 critical splice acceptor site probably null
R8228:Zfp335 UTSW 2 164904898 missense probably damaging 1.00
R8271:Zfp335 UTSW 2 164898053 missense probably damaging 0.98
R8688:Zfp335 UTSW 2 164892193 missense probably damaging 1.00
R8803:Zfp335 UTSW 2 164909370 missense probably benign 0.14
R9266:Zfp335 UTSW 2 164896087 missense probably benign 0.33
R9352:Zfp335 UTSW 2 164900322 missense probably damaging 0.99
R9487:Zfp335 UTSW 2 164893475 missense probably damaging 0.99
R9752:Zfp335 UTSW 2 164907427 critical splice donor site probably null
RF031:Zfp335 UTSW 2 164907463 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAACTGGAGCCCTCAAG -3'
(R):5'- AGGTGCTCTCTGAGGAGAATTCC -3'

Sequencing Primer
(F):5'- ACTGTGACTCTGACCATC -3'
(R):5'- TCTCTGAGGAGAATTCCCAGCC -3'
Posted On 2015-04-30