Mutagenetix > Incidental Mutation

Incidental Mutation 'R4019:Zfp335'

312676

Institutional Source

Beutler Lab

Gene Symbol

Zfp335

Ensembl Gene

ENSMUSG00000039834

Gene Name

zinc finger protein 335

Synonyms

1810045J01Rik

MMRRC Submission

040953-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4019 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

164891882-164911757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 164901460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 536 (R536H)

Ref Sequence

ENSEMBL: ENSMUSP00000038298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]

AlphaFold

A2A5K6

Predicted Effect

probably damaging
Transcript: ENSMUST00000041361
AA Change: R536H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: R536H

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART
ZnF_C2H2	591	613	2.53e-2	SMART
ZnF_C2H2	622	644	6.78e-3	SMART
ZnF_C2H2	650	673	8.22e-2	SMART
ZnF_C2H2	679	702	3.29e-1	SMART
low complexity region	711	726	N/A	INTRINSIC
internal_repeat_3	770	937	7.16e-5	PROSPERO
low complexity region	1005	1015	N/A	INTRINSIC
ZnF_C2H2	1019	1041	2.95e-3	SMART
ZnF_C2H2	1047	1069	5.5e-3	SMART
ZnF_C2H2	1075	1097	1.58e-3	SMART
ZnF_C2H2	1103	1126	3.34e-2	SMART
low complexity region	1288	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139247

SMART Domains

Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183830
AA Change: R536H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834
AA Change: R536H

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acy1	T	C	9: 106,436,779	T61A	possibly damaging	Het
Ap4e1	C	T	2: 127,061,926	S916F	probably benign	Het
Brpf1	G	A	6: 113,310,282	R157Q	probably damaging	Het
Canx	A	T	11: 50,299,245	S429T	probably damaging	Het
Casz1	C	T	4: 148,932,878	P208L	probably benign	Het
Ctnnd1	C	T	2: 84,619,958	R306H	probably damaging	Het
Dip2c	T	C	13: 9,614,365	V909A	probably damaging	Het
Epg5	C	A	18: 78,030,450	Q2511K	probably damaging	Het
Ghitm	G	A	14: 37,130,694	A143V	probably damaging	Het
Gm884	A	G	11: 103,615,293	S1950P	probably benign	Het
Gramd3	T	C	18: 56,478,954		probably null	Het
Ifitm3	T	C	7: 141,009,859	T94A	possibly damaging	Het
Ift81	G	A	5: 122,593,129	T321M	probably benign	Het
Ikbkb	C	T	8: 22,671,712	V387I	probably benign	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lpar5	A	G	6: 125,081,675	N120D	probably damaging	Het
Lrrtm2	T	C	18: 35,212,870	I460V	possibly damaging	Het
Naip5	T	C	13: 100,223,375	E451G	probably benign	Het
Naip5	T	C	13: 100,223,394	I445V	probably benign	Het
Nbas	A	G	12: 13,482,519	R1743G	probably damaging	Het
Notch1	T	C	2: 26,481,142	T311A	probably benign	Het
Olfr1211	A	G	2: 88,929,736	I193T	probably benign	Het
Olfr552	T	C	7: 102,604,642	F96S	probably damaging	Het
Oplah	A	G	15: 76,297,276	Y1155H	probably damaging	Het
Pcnx	C	T	12: 81,918,244	T395I	probably damaging	Het
Pdgfb	A	C	15: 80,001,722	V108G	probably damaging	Het
Pdzd3	A	T	9: 44,250,820		probably null	Het
Prpf40b	T	C	15: 99,316,476	S846P	probably benign	Het
Ptprc	T	A	1: 138,078,516	H752L	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Scn3a	A	G	2: 65,525,951		probably benign	Het
Sco1	T	G	11: 67,064,020	S284A	probably benign	Het
Slc25a10	T	A	11: 120,497,439	M227K	probably damaging	Het
Sox8	A	G	17: 25,570,297	Y76H	probably damaging	Het
Spdya	A	C	17: 71,556,314	K19N	possibly damaging	Het
Syngap1	C	T	17: 26,952,341		probably benign	Het
Sytl3	T	C	17: 6,736,493	S326P	probably damaging	Het
Tbl3	A	G	17: 24,704,721	V239A	probably damaging	Het
Tenm2	T	C	11: 36,047,074	I1592V	probably benign	Het
Vmn2r109	T	A	17: 20,553,812	D427V	probably benign	Het
Vmn2r115	A	G	17: 23,360,043	K830R	probably damaging	Het
Vmn2r45	A	T	7: 8,471,581	L816*	probably null	Het
Zfp777	T	A	6: 48,042,112	Q296L	probably damaging	Het

Other mutations in Zfp335

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Zfp335	APN	2	164892382	missense	probably damaging	1.00
IGL00921:Zfp335	APN	2	164894776	missense	possibly damaging	0.51
IGL00980:Zfp335	APN	2	164902674	nonsense	probably null
IGL01145:Zfp335	APN	2	164907502	missense	probably benign	0.03
IGL01568:Zfp335	APN	2	164894788	missense	possibly damaging	0.70
IGL01612:Zfp335	APN	2	164910620	critical splice donor site	probably null
IGL02138:Zfp335	APN	2	164893804	missense	probably damaging	1.00
IGL02675:Zfp335	APN	2	164910689	missense	probably benign
IGL03206:Zfp335	APN	2	164892681	splice site	probably benign
IGL03269:Zfp335	APN	2	164900354	missense	probably damaging	1.00
IGL03306:Zfp335	APN	2	164895984	splice site	probably benign
FR4342:Zfp335	UTSW	2	164907465	small insertion	probably benign
FR4342:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907483	small insertion	probably benign
FR4548:Zfp335	UTSW	2	164907472	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907475	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907484	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907478	small insertion	probably benign
PIT4403001:Zfp335	UTSW	2	164893716	missense	possibly damaging	0.56
R0005:Zfp335	UTSW	2	164909302	missense	possibly damaging	0.91
R0101:Zfp335	UTSW	2	164899990	missense	probably damaging	1.00
R0196:Zfp335	UTSW	2	164896145	missense	possibly damaging	0.88
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0533:Zfp335	UTSW	2	164907922	nonsense	probably null
R0865:Zfp335	UTSW	2	164899495	splice site	probably null
R1023:Zfp335	UTSW	2	164892585	missense	possibly damaging	0.88
R1029:Zfp335	UTSW	2	164892678	splice site	probably benign
R1052:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1106:Zfp335	UTSW	2	164907551	small deletion	probably benign
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1274:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1386:Zfp335	UTSW	2	164898241	missense	probably benign	0.00
R1433:Zfp335	UTSW	2	164899456	missense	probably damaging	0.99
R1813:Zfp335	UTSW	2	164892605	missense	probably damaging	0.99
R1959:Zfp335	UTSW	2	164894802	missense	probably damaging	1.00
R2372:Zfp335	UTSW	2	164895039	missense	probably damaging	1.00
R3847:Zfp335	UTSW	2	164900106	splice site	probably null
R3937:Zfp335	UTSW	2	164910700	missense	probably damaging	1.00
R3946:Zfp335	UTSW	2	164892189	missense	probably damaging	1.00
R3979:Zfp335	UTSW	2	164910638	missense	probably benign	0.00
R4020:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4668:Zfp335	UTSW	2	164900286	missense	probably damaging	1.00
R5000:Zfp335	UTSW	2	164894668	missense	probably benign
R5038:Zfp335	UTSW	2	164910644	nonsense	probably null
R5245:Zfp335	UTSW	2	164894758	missense	probably benign
R5411:Zfp335	UTSW	2	164902245	missense	probably damaging	0.99
R5422:Zfp335	UTSW	2	164907730	missense	probably damaging	1.00
R5968:Zfp335	UTSW	2	164892394	missense	probably damaging	0.99
R6056:Zfp335	UTSW	2	164895098	splice site	probably null
R6551:Zfp335	UTSW	2	164909365	missense	probably benign
R6927:Zfp335	UTSW	2	164893720	missense	probably damaging	1.00
R6943:Zfp335	UTSW	2	164894875	missense	possibly damaging	0.50
R6995:Zfp335	UTSW	2	164893290	nonsense	probably null
R7174:Zfp335	UTSW	2	164902503	missense	probably damaging	1.00
R7185:Zfp335	UTSW	2	164893244	critical splice donor site	probably null
R7296:Zfp335	UTSW	2	164900132	missense	probably damaging	0.99
R7322:Zfp335	UTSW	2	164910821	start codon destroyed	probably null	0.90
R7504:Zfp335	UTSW	2	164909418	missense	probably benign	0.27
R7560:Zfp335	UTSW	2	164895992	missense	probably damaging	1.00
R7637:Zfp335	UTSW	2	164892539	critical splice donor site	probably null
R8064:Zfp335	UTSW	2	164907700	missense	probably damaging	1.00
R8208:Zfp335	UTSW	2	164893616	critical splice acceptor site	probably null
R8228:Zfp335	UTSW	2	164904898	missense	probably damaging	1.00
R8271:Zfp335	UTSW	2	164898053	missense	probably damaging	0.98
R8688:Zfp335	UTSW	2	164892193	missense	probably damaging	1.00
R8803:Zfp335	UTSW	2	164909370	missense	probably benign	0.14
R9266:Zfp335	UTSW	2	164896087	missense	probably benign	0.33
R9352:Zfp335	UTSW	2	164900322	missense	probably damaging	0.99
R9487:Zfp335	UTSW	2	164893475	missense	probably damaging	0.99
RF031:Zfp335	UTSW	2	164907463	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGAACTGGAGCCCTCAAG -3'
(R):5'- AGGTGCTCTCTGAGGAGAATTCC -3'

Sequencing Primer
(F):5'- ACTGTGACTCTGACCATC -3'
(R):5'- TCTCTGAGGAGAATTCCCAGCC -3'

Posted On

2015-04-30