Incidental Mutation 'R4019:Brpf1'
ID312680
Institutional Source Beutler Lab
Gene Symbol Brpf1
Ensembl Gene ENSMUSG00000001632
Gene Namebromodomain and PHD finger containing, 1
Synonyms4930540D11Rik, 4833438B11Rik
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4019 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113307137-113324860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113310282 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 157 (R157Q)
Ref Sequence ENSEMBL: ENSMUSP00000108747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041203] [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626]
Predicted Effect probably benign
Transcript: ENSMUST00000041203
SMART Domains Protein: ENSMUSP00000044416
Gene: ENSMUSG00000030270

DomainStartEndE-ValueType
C2 14 122 2.12e-10 SMART
C2 143 257 5.15e-9 SMART
VWA 297 495 4.4e-10 SMART
low complexity region 536 553 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113117
AA Change: R157Q

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632
AA Change: R157Q

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113119
AA Change: R157Q

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632
AA Change: R157Q

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113121
AA Change: R157Q

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632
AA Change: R157Q

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113122
AA Change: R157Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632
AA Change: R157Q

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203569
Predicted Effect possibly damaging
Transcript: ENSMUST00000203577
AA Change: R157Q

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632
AA Change: R157Q

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204198
AA Change: R157Q

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632
AA Change: R157Q

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204626
AA Change: R157Q

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632
AA Change: R157Q

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain, PHD finger and chromo/Tudor-related Pro-Trp-Trp-Pro (PWWP) domain containing protein. The encoded protein is a component of the MOZ/MORF histone acetyltransferase complexes which function as a transcriptional regulators. This protein binds to the catalytic MYST domains of the MOZ and MORF proteins and may play a role in stimulating acetyltransferase and transcriptional activity of the complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality around E9.5 and disrupts histone acetylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Brpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Brpf1 APN 6 113316684 missense probably damaging 0.99
IGL00697:Brpf1 APN 6 113314986 missense probably damaging 1.00
IGL00823:Brpf1 APN 6 113321886 missense probably benign 0.01
IGL00951:Brpf1 APN 6 113322553 missense probably damaging 1.00
IGL01335:Brpf1 APN 6 113319337 missense probably damaging 0.99
IGL01565:Brpf1 APN 6 113316650 missense probably damaging 1.00
IGL02237:Brpf1 APN 6 113310375 missense probably damaging 1.00
R1484:Brpf1 UTSW 6 113315135 missense probably damaging 1.00
R1502:Brpf1 UTSW 6 113322420 missense probably damaging 1.00
R1517:Brpf1 UTSW 6 113319089 missense probably benign 0.17
R1525:Brpf1 UTSW 6 113317154 missense probably damaging 1.00
R1773:Brpf1 UTSW 6 113319931 missense possibly damaging 0.85
R1925:Brpf1 UTSW 6 113319930 missense probably damaging 0.96
R2928:Brpf1 UTSW 6 113322046 missense possibly damaging 0.95
R3900:Brpf1 UTSW 6 113318433 missense probably benign 0.20
R4630:Brpf1 UTSW 6 113309906 missense probably damaging 1.00
R4754:Brpf1 UTSW 6 113320447 missense possibly damaging 0.92
R4757:Brpf1 UTSW 6 113315111 missense probably damaging 1.00
R4858:Brpf1 UTSW 6 113317678 missense possibly damaging 0.56
R4866:Brpf1 UTSW 6 113322470 missense probably damaging 0.97
R5073:Brpf1 UTSW 6 113310254 missense probably damaging 0.97
R5197:Brpf1 UTSW 6 113319941 missense possibly damaging 0.57
R7011:Brpf1 UTSW 6 113318466 missense probably benign 0.00
R7585:Brpf1 UTSW 6 113315046 missense possibly damaging 0.58
R7655:Brpf1 UTSW 6 113314874 missense probably benign 0.02
R7656:Brpf1 UTSW 6 113314874 missense probably benign 0.02
R8008:Brpf1 UTSW 6 113319089 missense probably benign 0.00
R8222:Brpf1 UTSW 6 113310038 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGAGAGGTGATGAGCTATGC -3'
(R):5'- CTGGCTGTCTCCTATCAGACTG -3'

Sequencing Primer
(F):5'- AGCTATGCTCAGGCCCAG -3'
(R):5'- ATCAGACTGTCATCTCGATTGG -3'
Posted On2015-04-30