Incidental Mutation 'R4019:Lpar5'
ID312681
Institutional Source Beutler Lab
Gene Symbol Lpar5
Ensembl Gene ENSMUSG00000067714
Gene Namelysophosphatidic acid receptor 5
SynonymsLPA5, LOC381810, Gpr92, GPR93
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4019 (G1)
Quality Score148
Status Not validated
Chromosome6
Chromosomal Location125067920-125082472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125081675 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 120 (N120D)
Ref Sequence ENSEMBL: ENSMUSP00000132511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]
Predicted Effect probably damaging
Transcript: ENSMUST00000088292
AA Change: N120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714
AA Change: N120D

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 7.4e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140346
AA Change: N120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714
AA Change: N120D

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 164 1.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171989
AA Change: N120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714
AA Change: N120D

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203956
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Lpar5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Lpar5 APN 6 125082006 missense possibly damaging 0.94
IGL01830:Lpar5 APN 6 125081822 missense probably benign 0.01
IGL01975:Lpar5 APN 6 125081787 missense probably damaging 0.99
IGL02021:Lpar5 APN 6 125081992 nonsense probably null
IGL02718:Lpar5 APN 6 125082244 missense probably damaging 1.00
IGL03027:Lpar5 APN 6 125082240 missense probably damaging 1.00
IGL03300:Lpar5 APN 6 125082240 missense probably damaging 1.00
F5770:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
R0633:Lpar5 UTSW 6 125081991 missense probably benign 0.25
R1639:Lpar5 UTSW 6 125081601 missense probably damaging 1.00
R1822:Lpar5 UTSW 6 125081415 missense possibly damaging 0.76
R2227:Lpar5 UTSW 6 125081135 critical splice acceptor site probably null
R4288:Lpar5 UTSW 6 125081864 missense probably benign 0.00
R4705:Lpar5 UTSW 6 125082207 missense possibly damaging 0.64
R4787:Lpar5 UTSW 6 125082498 unclassified probably null
R5027:Lpar5 UTSW 6 125082147 missense possibly damaging 0.69
R6114:Lpar5 UTSW 6 125081676 missense probably damaging 1.00
R7197:Lpar5 UTSW 6 125082384 missense probably benign 0.00
R7779:Lpar5 UTSW 6 125082244 missense probably damaging 1.00
V7580:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7581:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7582:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
Z1176:Lpar5 UTSW 6 125081379 missense possibly damaging 0.92
Z1176:Lpar5 UTSW 6 125082072 missense probably damaging 1.00
Z1177:Lpar5 UTSW 6 125082018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGGTGGTCTACAGCCTGG -3'
(R):5'- TCTTGTACGTGCAGTGGGAC -3'

Sequencing Primer
(F):5'- GTATTGGCGACTGGTCTCCC -3'
(R):5'- TGGGACGGGCTGTGCAC -3'
Posted On2015-04-30