Mutagenetix > Incidental Mutation

Incidental Mutation 'R4019:Nbas'

312694

Institutional Source

Beutler Lab

Gene Symbol

Nbas

Ensembl Gene

ENSMUSG00000020576

Gene Name

neuroblastoma amplified sequence

Synonyms

4933425L03Rik

MMRRC Submission

040953-MU

Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4019 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13269133-13583811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13482519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1743 (R1743G)

Ref Sequence

ENSEMBL: ENSMUSP00000036082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042953]

AlphaFold

E9Q411

Predicted Effect

probably damaging
Transcript: ENSMUST00000042953
AA Change: R1743G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: R1743G

Domain	Start	End	E-Value	Type
Pfam:Nbas_N	89	370	4.7e-171	PFAM
low complexity region	463	475	N/A	INTRINSIC
low complexity region	653	667	N/A	INTRINSIC
Pfam:Sec39	725	1375	3.8e-34	PFAM
low complexity region	1392	1404	N/A	INTRINSIC
low complexity region	1549	1566	N/A	INTRINSIC
low complexity region	2226	2252	N/A	INTRINSIC
low complexity region	2275	2285	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221714

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222785

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223081

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]

Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acy1	T	C	9: 106,436,779	T61A	possibly damaging	Het
Ap4e1	C	T	2: 127,061,926	S916F	probably benign	Het
Brpf1	G	A	6: 113,310,282	R157Q	probably damaging	Het
Canx	A	T	11: 50,299,245	S429T	probably damaging	Het
Casz1	C	T	4: 148,932,878	P208L	probably benign	Het
Ctnnd1	C	T	2: 84,619,958	R306H	probably damaging	Het
Dip2c	T	C	13: 9,614,365	V909A	probably damaging	Het
Epg5	C	A	18: 78,030,450	Q2511K	probably damaging	Het
Ghitm	G	A	14: 37,130,694	A143V	probably damaging	Het
Gm884	A	G	11: 103,615,293	S1950P	probably benign	Het
Gramd3	T	C	18: 56,478,954		probably null	Het
Ifitm3	T	C	7: 141,009,859	T94A	possibly damaging	Het
Ift81	G	A	5: 122,593,129	T321M	probably benign	Het
Ikbkb	C	T	8: 22,671,712	V387I	probably benign	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lpar5	A	G	6: 125,081,675	N120D	probably damaging	Het
Lrrtm2	T	C	18: 35,212,870	I460V	possibly damaging	Het
Naip5	T	C	13: 100,223,375	E451G	probably benign	Het
Naip5	T	C	13: 100,223,394	I445V	probably benign	Het
Notch1	T	C	2: 26,481,142	T311A	probably benign	Het
Olfr1211	A	G	2: 88,929,736	I193T	probably benign	Het
Olfr552	T	C	7: 102,604,642	F96S	probably damaging	Het
Oplah	A	G	15: 76,297,276	Y1155H	probably damaging	Het
Pcnx	C	T	12: 81,918,244	T395I	probably damaging	Het
Pdgfb	A	C	15: 80,001,722	V108G	probably damaging	Het
Pdzd3	A	T	9: 44,250,820		probably null	Het
Prpf40b	T	C	15: 99,316,476	S846P	probably benign	Het
Ptprc	T	A	1: 138,078,516	H752L	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Scn3a	A	G	2: 65,525,951		probably benign	Het
Sco1	T	G	11: 67,064,020	S284A	probably benign	Het
Slc25a10	T	A	11: 120,497,439	M227K	probably damaging	Het
Sox8	A	G	17: 25,570,297	Y76H	probably damaging	Het
Spdya	A	C	17: 71,556,314	K19N	possibly damaging	Het
Syngap1	C	T	17: 26,952,341		probably benign	Het
Sytl3	T	C	17: 6,736,493	S326P	probably damaging	Het
Tbl3	A	G	17: 24,704,721	V239A	probably damaging	Het
Tenm2	T	C	11: 36,047,074	I1592V	probably benign	Het
Vmn2r109	T	A	17: 20,553,812	D427V	probably benign	Het
Vmn2r115	A	G	17: 23,360,043	K830R	probably damaging	Het
Vmn2r45	A	T	7: 8,471,581	L816*	probably null	Het
Zfp335	C	T	2: 164,901,460	R536H	probably damaging	Het
Zfp777	T	A	6: 48,042,112	Q296L	probably damaging	Het

Other mutations in Nbas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Nbas	APN	12	13453075	missense	probably benign	0.19
IGL00712:Nbas	APN	12	13362625	splice site	probably benign
IGL00808:Nbas	APN	12	13566120	splice site	probably benign
IGL00915:Nbas	APN	12	13374752	nonsense	probably null
IGL00923:Nbas	APN	12	13336284	missense	possibly damaging	0.46
IGL01152:Nbas	APN	12	13360958	missense	probably damaging	1.00
IGL01633:Nbas	APN	12	13483897	missense	probably damaging	1.00
IGL01672:Nbas	APN	12	13379649	missense	possibly damaging	0.63
IGL01799:Nbas	APN	12	13324400	splice site	probably benign
IGL01812:Nbas	APN	12	13453503	missense	probably damaging	1.00
IGL01934:Nbas	APN	12	13289879	splice site	probably benign
IGL02093:Nbas	APN	12	13560962	missense	probably benign	0.00
IGL02115:Nbas	APN	12	13317692	splice site	probably benign
IGL02175:Nbas	APN	12	13566259	critical splice donor site	probably null
IGL02268:Nbas	APN	12	13405397	missense	possibly damaging	0.94
IGL02483:Nbas	APN	12	13324294	missense	probably damaging	1.00
IGL02539:Nbas	APN	12	13272703	splice site	probably benign
IGL02557:Nbas	APN	12	13361028	missense	probably damaging	1.00
IGL02815:Nbas	APN	12	13310266	missense	probably damaging	1.00
IGL02951:Nbas	APN	12	13362541	missense	probably benign
IGL03131:Nbas	APN	12	13279416	missense	probably benign	0.03
IGL03214:Nbas	APN	12	13331110	splice site	probably benign
IGL03308:Nbas	APN	12	13324348	missense	possibly damaging	0.93
IGL03368:Nbas	APN	12	13328451	missense	probably benign	0.08
IGL03372:Nbas	APN	12	13534472	missense	probably damaging	1.00
IGL03391:Nbas	APN	12	13483749	missense	probably benign	0.28
medvedev	UTSW	12	13534577	critical splice donor site	probably null
oligarchs	UTSW	12	13520750	missense	possibly damaging	0.75
putin	UTSW	12	13321755	missense	probably damaging	1.00
1mM(1):Nbas	UTSW	12	13288728	missense	probably damaging	1.00
R0057:Nbas	UTSW	12	13390957	missense	probably benign	0.00
R0076:Nbas	UTSW	12	13324336	missense	probably damaging	1.00
R0153:Nbas	UTSW	12	13273876	splice site	probably benign
R0371:Nbas	UTSW	12	13331095	missense	probably damaging	0.97
R0449:Nbas	UTSW	12	13519108	missense	probably benign	0.18
R0791:Nbas	UTSW	12	13482633	missense	probably benign	0.28
R0931:Nbas	UTSW	12	13331114	splice site	probably benign
R1236:Nbas	UTSW	12	13269241	missense	probably damaging	1.00
R1371:Nbas	UTSW	12	13482378	splice site	probably benign
R1567:Nbas	UTSW	12	13285278	missense	possibly damaging	0.70
R1587:Nbas	UTSW	12	13558685	missense	probably benign
R1719:Nbas	UTSW	12	13560977	critical splice donor site	probably null
R1747:Nbas	UTSW	12	13335898	missense	probably benign	0.00
R1777:Nbas	UTSW	12	13513562	missense	probably benign	0.16
R1848:Nbas	UTSW	12	13413597	missense	probably damaging	0.97
R1856:Nbas	UTSW	12	13474229	missense	possibly damaging	0.56
R1891:Nbas	UTSW	12	13390972	missense	possibly damaging	0.92
R1911:Nbas	UTSW	12	13566144	missense	probably benign
R1912:Nbas	UTSW	12	13566144	missense	probably benign
R2006:Nbas	UTSW	12	13414741	splice site	probably null
R2054:Nbas	UTSW	12	13474206	missense	probably benign	0.36
R2065:Nbas	UTSW	12	13566157	missense	probably damaging	1.00
R2089:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2156:Nbas	UTSW	12	13441509	missense	probably damaging	1.00
R2164:Nbas	UTSW	12	13330646	missense	possibly damaging	0.74
R2339:Nbas	UTSW	12	13362592	missense	probably benign	0.12
R2398:Nbas	UTSW	12	13432945	missense	probably damaging	0.99
R3806:Nbas	UTSW	12	13482504	missense	probably damaging	1.00
R3855:Nbas	UTSW	12	13279414	missense	possibly damaging	0.50
R4083:Nbas	UTSW	12	13474191	missense	probably damaging	0.96
R4201:Nbas	UTSW	12	13374826	missense	probably benign	0.00
R4231:Nbas	UTSW	12	13393343	missense	probably damaging	0.98
R4552:Nbas	UTSW	12	13335937	critical splice donor site	probably null
R4560:Nbas	UTSW	12	13583527	missense	probably benign	0.00
R4728:Nbas	UTSW	12	13288739	missense	probably damaging	0.98
R4752:Nbas	UTSW	12	13482537	missense	possibly damaging	0.92
R4832:Nbas	UTSW	12	13483739	missense	probably benign	0.00
R4874:Nbas	UTSW	12	13321755	missense	probably damaging	1.00
R4988:Nbas	UTSW	12	13408265	missense	probably benign	0.45
R5020:Nbas	UTSW	12	13374712	missense	probably damaging	0.99
R5079:Nbas	UTSW	12	13374711	missense	probably damaging	1.00
R5129:Nbas	UTSW	12	13390960	missense	probably damaging	1.00
R5239:Nbas	UTSW	12	13441518	missense	probably benign	0.31
R5299:Nbas	UTSW	12	13441925	nonsense	probably null
R5351:Nbas	UTSW	12	13560849	missense	probably damaging	1.00
R5389:Nbas	UTSW	12	13534577	critical splice donor site	probably null
R5436:Nbas	UTSW	12	13374811	missense	probably damaging	1.00
R5654:Nbas	UTSW	12	13583475	missense	probably damaging	1.00
R5690:Nbas	UTSW	12	13336284	missense	probably damaging	1.00
R5842:Nbas	UTSW	12	13269266	critical splice donor site	probably null
R5959:Nbas	UTSW	12	13288801	missense	probably damaging	0.99
R5982:Nbas	UTSW	12	13393430	missense	probably benign	0.00
R6238:Nbas	UTSW	12	13482595	missense	probably benign
R6270:Nbas	UTSW	12	13324293	missense	probably damaging	1.00
R6363:Nbas	UTSW	12	13482576	missense	probably benign
R6424:Nbas	UTSW	12	13415733	critical splice donor site	probably null
R6458:Nbas	UTSW	12	13288749	missense	probably damaging	1.00
R6526:Nbas	UTSW	12	13405425	missense	probably damaging	1.00
R6654:Nbas	UTSW	12	13483874	nonsense	probably null
R7085:Nbas	UTSW	12	13285258	missense	probably damaging	1.00
R7179:Nbas	UTSW	12	13405397	missense	possibly damaging	0.94
R7197:Nbas	UTSW	12	13520750	missense	possibly damaging	0.75
R7378:Nbas	UTSW	12	13274219	missense	probably damaging	1.00
R7393:Nbas	UTSW	12	13393492	missense	probably damaging	1.00
R7425:Nbas	UTSW	12	13469880	missense	probably damaging	1.00
R7446:Nbas	UTSW	12	13393498	missense	probably benign	0.02
R7481:Nbas	UTSW	12	13356959	missense	probably damaging	0.97
R7535:Nbas	UTSW	12	13279389	missense	probably damaging	0.97
R7626:Nbas	UTSW	12	13558660	missense	probably benign	0.00
R7678:Nbas	UTSW	12	13415661	missense	probably damaging	0.97
R7912:Nbas	UTSW	12	13405457	missense	possibly damaging	0.91
R7964:Nbas	UTSW	12	13356895	missense	probably damaging	0.99
R8193:Nbas	UTSW	12	13433009	missense	probably damaging	1.00
R8325:Nbas	UTSW	12	13288795	missense	probably damaging	1.00
R8405:Nbas	UTSW	12	13279393	missense	probably damaging	1.00
R8437:Nbas	UTSW	12	13566250	missense	possibly damaging	0.46
R8559:Nbas	UTSW	12	13352808	missense	probably benign	0.00
R8684:Nbas	UTSW	12	13336367	missense	probably damaging	1.00
R8826:Nbas	UTSW	12	13352874	splice site	probably benign
R8921:Nbas	UTSW	12	13413589	missense	probably benign
R8956:Nbas	UTSW	12	13432922	missense	possibly damaging	0.51
R9083:Nbas	UTSW	12	13335855	missense	possibly damaging	0.56
R9172:Nbas	UTSW	12	13374750	missense	possibly damaging	0.65
R9430:Nbas	UTSW	12	13321653	missense	probably benign	0.35
R9627:Nbas	UTSW	12	13300202	missense	possibly damaging	0.76
R9649:Nbas	UTSW	12	13583416	missense	probably damaging	1.00
RF013:Nbas	UTSW	12	13279408	missense	possibly damaging	0.54
T0722:Nbas	UTSW	12	13352808	missense	probably benign	0.00
Z1176:Nbas	UTSW	12	13483876	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GTCTGCCAGGGATTAAAGATAATG -3'
(R):5'- TGATATATGAGCACAGCTGGC -3'

Sequencing Primer
(F):5'- GAAATTGAAAAGCGAGCCC -3'
(R):5'- CAGCTGGCTGTGTGTAGAAAATCC -3'

Posted On

2015-04-30