Incidental Mutation 'R4019:Naip5'
ID 312697
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Lgn1, Naip-rs3
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R4019 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100211739-100246323 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100223375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 451 (E451G)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably benign
Transcript: ENSMUST00000049789
AA Change: E451G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: E451G

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100223096 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
R8833:Naip5 UTSW 13 100222934 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100219830 missense probably benign
R8958:Naip5 UTSW 13 100217609 nonsense probably null
R9031:Naip5 UTSW 13 100219830 missense probably benign
R9032:Naip5 UTSW 13 100219830 missense probably benign
R9074:Naip5 UTSW 13 100221756 missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100229619 missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100222500 missense probably damaging 1.00
R9223:Naip5 UTSW 13 100227676 missense probably benign 0.05
R9358:Naip5 UTSW 13 100219830 missense probably benign
R9389:Naip5 UTSW 13 100219830 missense probably benign
R9403:Naip5 UTSW 13 100219830 missense probably benign
R9518:Naip5 UTSW 13 100221859 missense probably benign
R9568:Naip5 UTSW 13 100219830 missense probably benign
R9568:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9569:Naip5 UTSW 13 100219830 missense probably benign
R9569:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9570:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9572:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9581:Naip5 UTSW 13 100214686 missense probably benign 0.11
R9627:Naip5 UTSW 13 100219830 missense probably benign
R9725:Naip5 UTSW 13 100222276 missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9764:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9765:Naip5 UTSW 13 100230761 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTGGCCAGTCCCTGATC -3'
(R):5'- CTTCTCTCCACAGACTTGGGTAG -3'

Sequencing Primer
(F):5'- CCCTGATCTGGTGTGATGGAACTAAG -3'
(R):5'- CTCCACAGACTTGGGTAGGAGTG -3'
Posted On 2015-04-30