Incidental Mutation 'R4019:Oplah'
ID312701
Institutional Source Beutler Lab
Gene Symbol Oplah
Ensembl Gene ENSMUSG00000022562
Gene Name5-oxoprolinase (ATP-hydrolysing)
Synonyms
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4019 (G1)
Quality Score215
Status Not validated
Chromosome15
Chromosomal Location76296601-76328015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76297276 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1155 (Y1155H)
Ref Sequence ENSEMBL: ENSMUSP00000129100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023222] [ENSMUST00000074173] [ENSMUST00000163991] [ENSMUST00000164189] [ENSMUST00000171192] [ENSMUST00000171340] [ENSMUST00000230221]
Predicted Effect probably damaging
Transcript: ENSMUST00000023222
AA Change: Y1155H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023222
Gene: ENSMUSG00000022562
AA Change: Y1155H

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 1.5e-63 PFAM
Pfam:Hydantoinase_A 231 531 6.4e-109 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 734 1256 5.2e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074173
SMART Domains Protein: ENSMUSP00000073805
Gene: ENSMUSG00000049653

DomainStartEndE-ValueType
Pfam:Speriolin_N 1 176 5.1e-67 PFAM
Pfam:Speriolin_N 172 262 1.2e-25 PFAM
Pfam:Speriolin_C 334 480 1.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163977
Predicted Effect probably benign
Transcript: ENSMUST00000163991
SMART Domains Protein: ENSMUSP00000134687
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Exo_endo_phos 176 471 4.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164189
SMART Domains Protein: ENSMUSP00000131967
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 9.8e-61 PFAM
Pfam:Hydantoinase_A 231 531 6.9e-103 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 853 2.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170261
Predicted Effect probably benign
Transcript: ENSMUST00000171192
SMART Domains Protein: ENSMUSP00000133693
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171340
AA Change: Y1155H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129100
Gene: ENSMUSG00000022562
AA Change: Y1155H

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 2.8e-60 PFAM
Pfam:Hydantoinase_A 231 531 6.6e-102 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 1260 8.2e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230735
Meta Mutation Damage Score 0.5353 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homodimer, using ATP hydrolysis to catalyze the conversion of 5-oxo-L-proline to L-glutamate. Defects in this gene are a cause of 5-oxoprolinase deficiency (OPLAHD). [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Oplah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Oplah APN 15 76305748 missense probably damaging 1.00
IGL01132:Oplah APN 15 76300957 missense probably benign 0.28
IGL02252:Oplah APN 15 76304764 missense probably damaging 1.00
IGL02493:Oplah APN 15 76300955 nonsense probably null
R0033:Oplah UTSW 15 76297134 missense probably benign 0.03
R0418:Oplah UTSW 15 76298487 missense probably benign 0.06
R0609:Oplah UTSW 15 76302992 missense probably benign 0.00
R1374:Oplah UTSW 15 76306555 missense probably damaging 0.99
R1419:Oplah UTSW 15 76297920 missense probably benign 0.41
R1703:Oplah UTSW 15 76296667 missense probably benign 0.02
R1733:Oplah UTSW 15 76302483 nonsense probably null
R1959:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1960:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1961:Oplah UTSW 15 76297464 missense probably damaging 1.00
R2290:Oplah UTSW 15 76302725 missense probably benign 0.00
R3552:Oplah UTSW 15 76302094 missense possibly damaging 0.78
R4020:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4207:Oplah UTSW 15 76302710 missense probably damaging 1.00
R4512:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4514:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4525:Oplah UTSW 15 76305509 missense probably damaging 1.00
R4803:Oplah UTSW 15 76302768 missense probably damaging 1.00
R5042:Oplah UTSW 15 76305709 nonsense probably null
R5259:Oplah UTSW 15 76301210 intron probably null
R5284:Oplah UTSW 15 76306559 missense probably benign 0.00
R5503:Oplah UTSW 15 76305446 critical splice donor site probably null
R5511:Oplah UTSW 15 76305744 missense possibly damaging 0.74
R5549:Oplah UTSW 15 76298266 missense probably damaging 0.98
R5594:Oplah UTSW 15 76296637 makesense probably null
R5631:Oplah UTSW 15 76305241 missense probably benign 0.01
R5849:Oplah UTSW 15 76297347 unclassified probably benign
R6776:Oplah UTSW 15 76300853 missense possibly damaging 0.94
R7105:Oplah UTSW 15 76297687 missense probably damaging 1.00
R7146:Oplah UTSW 15 76302660 missense probably benign
R7267:Oplah UTSW 15 76305009 missense probably benign 0.00
R7403:Oplah UTSW 15 76305009 missense probably benign 0.00
R7786:Oplah UTSW 15 76309716 missense possibly damaging 0.93
X0065:Oplah UTSW 15 76305163 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAAGCCACGTGTACCAGGC -3'
(R):5'- CAATGTGACCCTGGGCAATG -3'

Sequencing Primer
(F):5'- AGGCTCTCCCCCTGTAGAAG -3'
(R):5'- CCGTATGGGCTACTATGAGAC -3'
Posted On2015-04-30