Incidental Mutation 'R4019:Tbl3'
ID312707
Institutional Source Beutler Lab
Gene Symbol Tbl3
Ensembl Gene ENSMUSG00000040688
Gene Nametransducin (beta)-like 3
Synonyms
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R4019 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24697949-24707660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24704721 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 239 (V239A)
Ref Sequence ENSEMBL: ENSMUSP00000120911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124864
Predicted Effect probably damaging
Transcript: ENSMUST00000126319
AA Change: V239A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688
AA Change: V239A

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130633
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150313
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Tbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Tbl3 APN 17 24701905 splice site probably benign
IGL01092:Tbl3 APN 17 24705252 missense probably damaging 1.00
IGL01601:Tbl3 APN 17 24702317 missense probably damaging 1.00
IGL01610:Tbl3 APN 17 24704044 missense probably damaging 1.00
IGL02214:Tbl3 APN 17 24704132 unclassified probably benign
IGL03027:Tbl3 APN 17 24701193 critical splice acceptor site probably null
FR4449:Tbl3 UTSW 17 24702544 unclassified probably benign
R0230:Tbl3 UTSW 17 24701333 missense probably damaging 1.00
R0288:Tbl3 UTSW 17 24701807 missense probably damaging 1.00
R0305:Tbl3 UTSW 17 24705461 missense probably damaging 1.00
R1104:Tbl3 UTSW 17 24701606 missense probably benign 0.02
R1920:Tbl3 UTSW 17 24704503 missense probably benign 0.04
R2513:Tbl3 UTSW 17 24704550 critical splice acceptor site probably null
R2570:Tbl3 UTSW 17 24703316 missense possibly damaging 0.47
R2851:Tbl3 UTSW 17 24702583 missense probably damaging 1.00
R3905:Tbl3 UTSW 17 24702032 missense probably damaging 1.00
R3944:Tbl3 UTSW 17 24700708 missense possibly damaging 0.94
R4745:Tbl3 UTSW 17 24705330 unclassified probably benign
R5288:Tbl3 UTSW 17 24705970 missense possibly damaging 0.88
R5605:Tbl3 UTSW 17 24700759 missense probably benign 0.06
R5791:Tbl3 UTSW 17 24704434 missense probably damaging 0.99
R6236:Tbl3 UTSW 17 24700743 missense probably benign 0.12
R6302:Tbl3 UTSW 17 24704671 missense probably benign 0.05
R6938:Tbl3 UTSW 17 24705213 missense possibly damaging 0.61
R7173:Tbl3 UTSW 17 24705259 missense probably benign
R7176:Tbl3 UTSW 17 24700758 missense probably benign 0.01
R7382:Tbl3 UTSW 17 24705291 missense probably benign 0.21
R7555:Tbl3 UTSW 17 24701976 critical splice donor site probably null
R7732:Tbl3 UTSW 17 24704162 missense probably benign 0.00
R7780:Tbl3 UTSW 17 24702231 missense probably damaging 1.00
R7899:Tbl3 UTSW 17 24702484 missense probably damaging 1.00
R8108:Tbl3 UTSW 17 24700916 missense probably benign
RF005:Tbl3 UTSW 17 24702541 unclassified probably benign
X0022:Tbl3 UTSW 17 24705573 nonsense probably null
X0028:Tbl3 UTSW 17 24702321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTATACACACTGCCCAGAAGC -3'
(R):5'- AGGGACCTGCTTTTCCTCAG -3'

Sequencing Primer
(F):5'- CACACGAAGGATCCCTGTAGG -3'
(R):5'- AGCTCTGGCCGTGACAAGATC -3'
Posted On2015-04-30