Incidental Mutation 'R4019:Sox8'
ID312708
Institutional Source Beutler Lab
Gene Symbol Sox8
Ensembl Gene ENSMUSG00000024176
Gene NameSRY (sex determining region Y)-box 8
Synonyms
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4019 (G1)
Quality Score149
Status Not validated
Chromosome17
Chromosomal Location25565892-25570686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25570297 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 76 (Y76H)
Ref Sequence ENSEMBL: ENSMUSP00000133403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025003] [ENSMUST00000173447]
Predicted Effect probably damaging
Transcript: ENSMUST00000025003
AA Change: Y76H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025003
Gene: ENSMUSG00000024176
AA Change: Y76H

DomainStartEndE-ValueType
Pfam:Sox_N 18 86 3.8e-27 PFAM
HMG 98 168 3.86e-28 SMART
low complexity region 208 228 N/A INTRINSIC
low complexity region 303 321 N/A INTRINSIC
low complexity region 375 397 N/A INTRINSIC
low complexity region 407 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163493
Predicted Effect probably damaging
Transcript: ENSMUST00000173447
AA Change: Y76H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133403
Gene: ENSMUSG00000024176
AA Change: Y76H

DomainStartEndE-ValueType
Pfam:Sox_N 3 87 3.3e-25 PFAM
HMG 98 168 3.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174560
SMART Domains Protein: ENSMUSP00000133742
Gene: ENSMUSG00000024176

DomainStartEndE-ValueType
HMG 1 66 1.19e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 30% decrease in adult body weight due to diminished fat stores, and a reduction of several tarsals which subsequently fail to fuse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Sox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Sox8 APN 17 25567528 splice site probably null
IGL01918:Sox8 APN 17 25570137 missense probably damaging 1.00
IGL02672:Sox8 APN 17 25568989 missense probably damaging 1.00
IGL03371:Sox8 APN 17 25567440 missense probably damaging 1.00
R1398:Sox8 UTSW 17 25567883 missense probably benign 0.01
R1673:Sox8 UTSW 17 25567482 missense possibly damaging 0.77
R1742:Sox8 UTSW 17 25567941 missense probably damaging 0.99
R4353:Sox8 UTSW 17 25567335 makesense probably null
R4466:Sox8 UTSW 17 25568905 missense probably benign 0.37
R4893:Sox8 UTSW 17 25568989 missense probably damaging 1.00
R4929:Sox8 UTSW 17 25570356 missense probably benign 0.21
R5915:Sox8 UTSW 17 25567469 missense probably damaging 1.00
R6114:Sox8 UTSW 17 25567520 missense probably damaging 1.00
R6915:Sox8 UTSW 17 25567914 missense probably damaging 1.00
R7030:Sox8 UTSW 17 25570108 critical splice donor site probably null
R7232:Sox8 UTSW 17 25567540 missense probably benign 0.01
R7549:Sox8 UTSW 17 25567961 missense probably damaging 0.99
R8262:Sox8 UTSW 17 25567643 missense possibly damaging 0.89
R8862:Sox8 UTSW 17 25568071 missense possibly damaging 0.81
Z1177:Sox8 UTSW 17 25567743 missense probably benign 0.00
Z1177:Sox8 UTSW 17 25568984 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACGAAGTCACTCCTTTC -3'
(R):5'- CTAGCTCCATGTCACACGTG -3'

Sequencing Primer
(F):5'- TTCCTCAGCCTGAGTGTCAAGAG -3'
(R):5'- CATGTCACACGTGGAGGATTC -3'
Posted On2015-04-30