Incidental Mutation 'R4019:Epg5'
ID 312712
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules 5 autophagy tethering factor
Synonyms 5430411K18Rik
MMRRC Submission 040953-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R4019 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 77981680-78078228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78073665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 2511 (Q2511K)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: Q2511K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: Q2511K

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,313,978 (GRCm39) T61A possibly damaging Het
Ap4e1 C T 2: 126,903,846 (GRCm39) S916F probably benign Het
Brpf1 G A 6: 113,287,243 (GRCm39) R157Q probably damaging Het
Canx A T 11: 50,190,072 (GRCm39) S429T probably damaging Het
Casz1 C T 4: 149,017,335 (GRCm39) P208L probably benign Het
Ctnnd1 C T 2: 84,450,302 (GRCm39) R306H probably damaging Het
Dip2c T C 13: 9,664,401 (GRCm39) V909A probably damaging Het
Ghitm G A 14: 36,852,651 (GRCm39) A143V probably damaging Het
Gramd2b T C 18: 56,612,026 (GRCm39) probably null Het
Ifitm3 T C 7: 140,589,772 (GRCm39) T94A possibly damaging Het
Ift81 G A 5: 122,731,192 (GRCm39) T321M probably benign Het
Ikbkb C T 8: 23,161,728 (GRCm39) V387I probably benign Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lpar5 A G 6: 125,058,638 (GRCm39) N120D probably damaging Het
Lrrc37 A G 11: 103,506,119 (GRCm39) S1950P probably benign Het
Lrrtm2 T C 18: 35,345,923 (GRCm39) I460V possibly damaging Het
Naip5 T C 13: 100,359,883 (GRCm39) E451G probably benign Het
Naip5 T C 13: 100,359,902 (GRCm39) I445V probably benign Het
Nbas A G 12: 13,532,520 (GRCm39) R1743G probably damaging Het
Nherf4 A T 9: 44,162,117 (GRCm39) probably null Het
Notch1 T C 2: 26,371,154 (GRCm39) T311A probably benign Het
Oplah A G 15: 76,181,476 (GRCm39) Y1155H probably damaging Het
Or4c15 A G 2: 88,760,080 (GRCm39) I193T probably benign Het
Or52k2 T C 7: 102,253,849 (GRCm39) F96S probably damaging Het
Pcnx1 C T 12: 81,965,018 (GRCm39) T395I probably damaging Het
Pdgfb A C 15: 79,885,923 (GRCm39) V108G probably damaging Het
Prpf40b T C 15: 99,214,357 (GRCm39) S846P probably benign Het
Ptprc T A 1: 138,006,254 (GRCm39) H752L probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Scn3a A G 2: 65,356,295 (GRCm39) probably benign Het
Sco1 T G 11: 66,954,846 (GRCm39) S284A probably benign Het
Slc25a10 T A 11: 120,388,265 (GRCm39) M227K probably damaging Het
Sox8 A G 17: 25,789,271 (GRCm39) Y76H probably damaging Het
Spdya A C 17: 71,863,309 (GRCm39) K19N possibly damaging Het
Syngap1 C T 17: 27,171,315 (GRCm39) probably benign Het
Sytl3 T C 17: 7,003,892 (GRCm39) S326P probably damaging Het
Tbl3 A G 17: 24,923,695 (GRCm39) V239A probably damaging Het
Tenm2 T C 11: 35,937,901 (GRCm39) I1592V probably benign Het
Vmn2r109 T A 17: 20,774,074 (GRCm39) D427V probably benign Het
Vmn2r115 A G 17: 23,579,017 (GRCm39) K830R probably damaging Het
Vmn2r45 A T 7: 8,474,580 (GRCm39) L816* probably null Het
Zfp335 C T 2: 164,743,380 (GRCm39) R536H probably damaging Het
Zfp777 T A 6: 48,019,046 (GRCm39) Q296L probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78,055,956 (GRCm39) missense probably damaging 1.00
IGL01778:Epg5 APN 18 78,062,489 (GRCm39) missense probably damaging 0.98
IGL01936:Epg5 APN 18 78,028,316 (GRCm39) missense probably damaging 1.00
IGL02189:Epg5 APN 18 78,056,085 (GRCm39) missense probably damaging 0.99
IGL02323:Epg5 APN 18 78,056,047 (GRCm39) nonsense probably null
IGL02567:Epg5 APN 18 78,076,288 (GRCm39) missense probably damaging 1.00
IGL02805:Epg5 APN 18 78,073,406 (GRCm39) splice site probably benign
IGL03282:Epg5 APN 18 78,029,641 (GRCm39) missense probably benign 0.25
stitch UTSW 18 77,991,514 (GRCm39) nonsense probably null
R0011:Epg5 UTSW 18 77,991,698 (GRCm39) missense probably benign
R0172:Epg5 UTSW 18 78,070,574 (GRCm39) missense probably benign 0.00
R0335:Epg5 UTSW 18 78,029,687 (GRCm39) missense probably benign 0.25
R0380:Epg5 UTSW 18 78,004,056 (GRCm39) missense probably damaging 1.00
R0441:Epg5 UTSW 18 78,066,486 (GRCm39) splice site probably benign
R0443:Epg5 UTSW 18 77,999,118 (GRCm39) splice site probably benign
R0445:Epg5 UTSW 18 78,057,399 (GRCm39) missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78,066,580 (GRCm39) missense probably damaging 1.00
R0892:Epg5 UTSW 18 78,011,843 (GRCm39) missense possibly damaging 0.94
R1081:Epg5 UTSW 18 78,002,748 (GRCm39) missense possibly damaging 0.92
R1183:Epg5 UTSW 18 78,003,926 (GRCm39) missense probably damaging 1.00
R1374:Epg5 UTSW 18 78,024,541 (GRCm39) missense probably benign
R1428:Epg5 UTSW 18 78,005,642 (GRCm39) missense probably damaging 1.00
R1727:Epg5 UTSW 18 78,059,030 (GRCm39) missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78,067,205 (GRCm39) missense probably damaging 0.99
R1801:Epg5 UTSW 18 78,026,705 (GRCm39) missense possibly damaging 0.63
R1864:Epg5 UTSW 18 78,018,246 (GRCm39) missense probably damaging 0.99
R1908:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1909:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1916:Epg5 UTSW 18 78,008,236 (GRCm39) missense probably benign 0.00
R1986:Epg5 UTSW 18 78,025,521 (GRCm39) critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78,067,202 (GRCm39) missense probably damaging 0.98
R2080:Epg5 UTSW 18 77,991,960 (GRCm39) missense probably benign 0.01
R2106:Epg5 UTSW 18 78,034,578 (GRCm39) nonsense probably null
R2144:Epg5 UTSW 18 77,997,412 (GRCm39) missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78,070,517 (GRCm39) missense probably benign
R2217:Epg5 UTSW 18 77,992,287 (GRCm39) missense probably benign
R2424:Epg5 UTSW 18 78,011,828 (GRCm39) missense probably benign 0.05
R2909:Epg5 UTSW 18 78,026,691 (GRCm39) missense probably damaging 1.00
R3725:Epg5 UTSW 18 78,060,894 (GRCm39) missense probably benign 0.00
R3899:Epg5 UTSW 18 78,000,725 (GRCm39) missense probably damaging 1.00
R4260:Epg5 UTSW 18 78,058,914 (GRCm39) missense probably damaging 1.00
R4260:Epg5 UTSW 18 78,002,336 (GRCm39) missense possibly damaging 0.50
R4448:Epg5 UTSW 18 78,005,676 (GRCm39) missense probably damaging 1.00
R4475:Epg5 UTSW 18 77,991,723 (GRCm39) missense probably benign
R4612:Epg5 UTSW 18 78,025,629 (GRCm39) missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78,056,079 (GRCm39) missense probably benign 0.45
R4767:Epg5 UTSW 18 78,066,498 (GRCm39) missense possibly damaging 0.67
R4779:Epg5 UTSW 18 78,034,580 (GRCm39) missense probably benign 0.01
R4791:Epg5 UTSW 18 77,992,211 (GRCm39) nonsense probably null
R4797:Epg5 UTSW 18 78,073,614 (GRCm39) missense probably benign 0.00
R4812:Epg5 UTSW 18 78,022,399 (GRCm39) missense probably benign 0.01
R4899:Epg5 UTSW 18 78,028,272 (GRCm39) missense probably damaging 1.00
R5000:Epg5 UTSW 18 77,997,376 (GRCm39) missense probably benign
R5031:Epg5 UTSW 18 78,072,163 (GRCm39) missense probably benign 0.00
R5050:Epg5 UTSW 18 78,019,156 (GRCm39) missense possibly damaging 0.55
R5114:Epg5 UTSW 18 78,038,828 (GRCm39) missense probably benign
R5144:Epg5 UTSW 18 78,058,895 (GRCm39) missense probably damaging 1.00
R5209:Epg5 UTSW 18 77,994,497 (GRCm39) missense probably damaging 1.00
R5213:Epg5 UTSW 18 78,058,049 (GRCm39) missense probably benign 0.01
R5270:Epg5 UTSW 18 78,026,778 (GRCm39) missense possibly damaging 0.79
R5324:Epg5 UTSW 18 78,005,660 (GRCm39) missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78,070,712 (GRCm39) missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77,994,422 (GRCm39) missense possibly damaging 0.81
R5593:Epg5 UTSW 18 78,000,689 (GRCm39) missense probably damaging 1.00
R5718:Epg5 UTSW 18 78,029,618 (GRCm39) missense probably damaging 1.00
R5773:Epg5 UTSW 18 78,004,040 (GRCm39) missense probably damaging 1.00
R5828:Epg5 UTSW 18 78,064,066 (GRCm39) missense probably damaging 0.99
R5847:Epg5 UTSW 18 78,073,270 (GRCm39) missense probably benign 0.06
R5858:Epg5 UTSW 18 77,991,514 (GRCm39) nonsense probably null
R5914:Epg5 UTSW 18 78,002,847 (GRCm39) critical splice donor site probably null
R6124:Epg5 UTSW 18 78,073,260 (GRCm39) missense probably benign
R6228:Epg5 UTSW 18 77,991,677 (GRCm39) missense possibly damaging 0.90
R6252:Epg5 UTSW 18 78,028,382 (GRCm39) missense probably damaging 1.00
R6269:Epg5 UTSW 18 77,991,585 (GRCm39) missense probably benign
R6312:Epg5 UTSW 18 78,022,426 (GRCm39) missense possibly damaging 0.72
R6320:Epg5 UTSW 18 78,005,613 (GRCm39) missense probably damaging 1.00
R6328:Epg5 UTSW 18 78,072,179 (GRCm39) missense possibly damaging 0.88
R6430:Epg5 UTSW 18 78,019,100 (GRCm39) missense probably damaging 1.00
R6458:Epg5 UTSW 18 77,991,469 (GRCm39) missense probably benign 0.03
R6852:Epg5 UTSW 18 78,056,106 (GRCm39) missense probably damaging 1.00
R6915:Epg5 UTSW 18 78,022,380 (GRCm39) missense probably benign 0.00
R6930:Epg5 UTSW 18 78,057,378 (GRCm39) missense probably damaging 0.99
R6932:Epg5 UTSW 18 77,991,824 (GRCm39) missense probably benign 0.00
R7127:Epg5 UTSW 18 78,072,140 (GRCm39) missense probably damaging 1.00
R7207:Epg5 UTSW 18 77,992,170 (GRCm39) missense probably damaging 1.00
R7225:Epg5 UTSW 18 78,055,917 (GRCm39) missense probably benign 0.45
R7358:Epg5 UTSW 18 78,002,252 (GRCm39) missense possibly damaging 0.78
R7414:Epg5 UTSW 18 78,026,747 (GRCm39) missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78,066,493 (GRCm39) missense probably benign 0.01
R7535:Epg5 UTSW 18 78,076,141 (GRCm39) missense probably benign 0.18
R7586:Epg5 UTSW 18 78,073,275 (GRCm39) missense probably benign
R7651:Epg5 UTSW 18 78,024,615 (GRCm39) nonsense probably null
R7715:Epg5 UTSW 18 78,011,801 (GRCm39) missense probably damaging 1.00
R7753:Epg5 UTSW 18 77,991,560 (GRCm39) missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78,052,929 (GRCm39) critical splice donor site probably null
R8114:Epg5 UTSW 18 78,073,365 (GRCm39) missense probably benign 0.41
R8124:Epg5 UTSW 18 78,008,211 (GRCm39) missense probably benign 0.05
R8307:Epg5 UTSW 18 78,065,894 (GRCm39) missense probably damaging 1.00
R8458:Epg5 UTSW 18 77,991,946 (GRCm39) missense probably benign 0.00
R8751:Epg5 UTSW 18 78,008,225 (GRCm39) missense probably benign 0.28
R8751:Epg5 UTSW 18 78,008,224 (GRCm39) missense possibly damaging 0.65
R8751:Epg5 UTSW 18 78,008,223 (GRCm39) missense probably benign 0.07
R8888:Epg5 UTSW 18 78,056,086 (GRCm39) missense possibly damaging 0.76
R8971:Epg5 UTSW 18 78,022,434 (GRCm39) missense probably damaging 1.00
R9045:Epg5 UTSW 18 77,992,014 (GRCm39) missense probably damaging 1.00
R9291:Epg5 UTSW 18 78,056,065 (GRCm39) nonsense probably null
R9327:Epg5 UTSW 18 77,991,435 (GRCm39) missense probably benign 0.00
R9365:Epg5 UTSW 18 77,997,957 (GRCm39) missense probably damaging 1.00
R9742:Epg5 UTSW 18 78,024,170 (GRCm39) missense probably damaging 1.00
X0023:Epg5 UTSW 18 78,011,872 (GRCm39) missense probably damaging 0.99
X0060:Epg5 UTSW 18 78,005,700 (GRCm39) missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 78,002,354 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCAGGCATGTAGTAGGAC -3'
(R):5'- AGGAAGCTCACTTGTCACATC -3'

Sequencing Primer
(F):5'- AGCGCTCACCTTAGTAGT -3'
(R):5'- GAACCCTAGAGCAGCTTGC -3'
Posted On 2015-04-30