Incidental Mutation 'R4020:Erich3'
ID312721
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4020 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 154714049 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 260 (R260H)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051862] [ENSMUST00000098496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051862
AA Change: R63H

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062837
Gene: ENSMUSG00000078161
AA Change: R63H

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:DUF4590 102 217 9.8e-62 PFAM
low complexity region 299 327 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 408 420 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098496
AA Change: R260H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: R260H

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172865
AA Change: R260H

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133995
Gene: ENSMUSG00000042943
AA Change: R260H

DomainStartEndE-ValueType
Pfam:DUF4590 300 413 2.6e-58 PFAM
low complexity region 496 524 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192912
Meta Mutation Damage Score 0.1562 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
R7400:Erich3 UTSW 3 154762577 missense
R7421:Erich3 UTSW 3 154733561 missense probably damaging 1.00
R7520:Erich3 UTSW 3 154763126 missense unknown
R7553:Erich3 UTSW 3 154733500 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCTGGGTTTGTGACAGTC -3'
(R):5'- TATAGGGGAATGTCAGGGCC -3'

Sequencing Primer
(F):5'- GTTTGTGACAGTCATCCAAGC -3'
(R):5'- GGTTTTCGGAGGGGAAACTAG -3'
Posted On2015-04-30