Incidental Mutation 'R4020:Asb4'
ID312724
Institutional Source Beutler Lab
Gene Symbol Asb4
Ensembl Gene ENSMUSG00000042607
Gene Nameankyrin repeat and SOCS box-containing 4
Synonyms
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R4020 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5383386-5433022 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 5390803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043294] [ENSMUST00000183358]
Predicted Effect probably benign
Transcript: ENSMUST00000043294
SMART Domains Protein: ENSMUSP00000040331
Gene: ENSMUSG00000042607

DomainStartEndE-ValueType
ANK 74 103 6.26e-2 SMART
ANK 106 135 4.46e-7 SMART
ANK 139 168 4.86e1 SMART
ANK 174 203 2.43e1 SMART
ANK 207 247 1.17e2 SMART
ANK 251 280 8.86e-2 SMART
SOCS_box 381 420 7.48e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183358
SMART Domains Protein: ENSMUSP00000139245
Gene: ENSMUSG00000042607

DomainStartEndE-ValueType
ANK 74 103 6.26e-2 SMART
ANK 106 135 4.46e-7 SMART
ANK 139 168 1.02e3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired placentation, embryonic growth arrest, reduced litter size, and pre-eclampsia like features including hypertension and albuminuria in late-stage pregnant females as well as renal defects including glomerular endotheliosis and mesangial expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Asb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Asb4 APN 6 5398386 missense probably benign 0.00
IGL03015:Asb4 APN 6 5398515 missense possibly damaging 0.75
IGL03280:Asb4 APN 6 5423416 missense probably benign
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1267:Asb4 UTSW 6 5423747 missense probably damaging 1.00
R1435:Asb4 UTSW 6 5398410 missense probably benign 0.33
R1595:Asb4 UTSW 6 5390692 missense probably damaging 1.00
R1764:Asb4 UTSW 6 5390798 splice site probably null
R2118:Asb4 UTSW 6 5390687 missense probably benign
R3976:Asb4 UTSW 6 5390771 missense probably benign 0.01
R4067:Asb4 UTSW 6 5423651 missense probably damaging 1.00
R4469:Asb4 UTSW 6 5423409 missense probably benign 0.01
R4895:Asb4 UTSW 6 5398266 missense probably damaging 0.98
R5432:Asb4 UTSW 6 5430912 missense probably damaging 1.00
R5444:Asb4 UTSW 6 5431040 missense probably damaging 0.98
R6196:Asb4 UTSW 6 5390699 missense probably benign 0.05
R6276:Asb4 UTSW 6 5431043 missense probably damaging 1.00
R6333:Asb4 UTSW 6 5423597 missense probably damaging 1.00
R6922:Asb4 UTSW 6 5398304 missense possibly damaging 0.87
R7098:Asb4 UTSW 6 5398499 missense probably damaging 1.00
R7196:Asb4 UTSW 6 5423356 missense probably benign 0.00
R7547:Asb4 UTSW 6 5398350 missense probably damaging 1.00
R7561:Asb4 UTSW 6 5430968 missense possibly damaging 0.87
R7707:Asb4 UTSW 6 5430968 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATCATTGCTCCGCTTCCACAG -3'
(R):5'- AATTCCAGGCGCAAGAATGG -3'

Sequencing Primer
(F):5'- GGATGGACGGCATCACTG -3'
(R):5'- TGTATGGATCTATGAAAATCACCCCC -3'
Posted On2015-04-30