Incidental Mutation 'R4020:Nfrkb'
ID312738
Institutional Source Beutler Lab
Gene Symbol Nfrkb
Ensembl Gene ENSMUSG00000042185
Gene Namenuclear factor related to kappa B binding protein
SynonymsA530090G11Rik
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R4020 (G1)
Quality Score212
Status Validated
Chromosome9
Chromosomal Location31386192-31421333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31414111 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 950 (L950Q)
Ref Sequence ENSEMBL: ENSMUSP00000083341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086167] [ENSMUST00000132329] [ENSMUST00000152593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086167
AA Change: L950Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083341
Gene: ENSMUSG00000042185
AA Change: L950Q

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
coiled coil region 304 335 N/A INTRINSIC
Pfam:NFRKB_winged 379 478 4.5e-35 PFAM
low complexity region 663 690 N/A INTRINSIC
low complexity region 700 740 N/A INTRINSIC
internal_repeat_1 879 953 2.02e-5 PROSPERO
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
internal_repeat_1 1128 1201 2.02e-5 PROSPERO
low complexity region 1239 1255 N/A INTRINSIC
low complexity region 1269 1290 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128375
Predicted Effect probably benign
Transcript: ENSMUST00000132329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143558
Predicted Effect probably benign
Transcript: ENSMUST00000152593
SMART Domains Protein: ENSMUSP00000119025
Gene: ENSMUSG00000042185

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Nfrkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Nfrkb APN 9 31389049 missense probably damaging 0.99
IGL01343:Nfrkb APN 9 31388954 missense probably damaging 0.99
IGL01363:Nfrkb APN 9 31414371 missense possibly damaging 0.53
IGL01647:Nfrkb APN 9 31396505 splice site probably benign
IGL01655:Nfrkb APN 9 31403459 missense probably benign 0.09
IGL01735:Nfrkb APN 9 31410139 missense possibly damaging 0.73
IGL01926:Nfrkb APN 9 31414179 missense probably benign 0.01
IGL01929:Nfrkb APN 9 31419873 missense possibly damaging 0.73
IGL02095:Nfrkb APN 9 31411231 missense probably damaging 0.97
IGL02370:Nfrkb APN 9 31389012 missense probably benign 0.08
IGL02525:Nfrkb APN 9 31414516 missense possibly damaging 0.73
R0325:Nfrkb UTSW 9 31414180 missense probably benign 0.06
R0390:Nfrkb UTSW 9 31388897 start gained probably benign
R0558:Nfrkb UTSW 9 31410268 missense possibly damaging 0.73
R0670:Nfrkb UTSW 9 31420173 missense probably benign 0.33
R1329:Nfrkb UTSW 9 31414647 missense possibly damaging 0.93
R1729:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1730:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1894:Nfrkb UTSW 9 31414768 missense probably benign 0.02
R1975:Nfrkb UTSW 9 31414684 missense possibly damaging 0.86
R2022:Nfrkb UTSW 9 31411250 missense probably benign 0.04
R2175:Nfrkb UTSW 9 31389014 missense possibly damaging 0.73
R3793:Nfrkb UTSW 9 31409932 splice site probably benign
R4425:Nfrkb UTSW 9 31399962 missense probably damaging 0.99
R4727:Nfrkb UTSW 9 31403623 missense probably damaging 0.99
R4730:Nfrkb UTSW 9 31410251 missense probably benign 0.33
R4775:Nfrkb UTSW 9 31419049 missense possibly damaging 0.86
R5032:Nfrkb UTSW 9 31389055 splice site probably null
R5532:Nfrkb UTSW 9 31397779 missense probably damaging 1.00
R5635:Nfrkb UTSW 9 31399298 missense probably damaging 0.98
R5712:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R5720:Nfrkb UTSW 9 31394742 missense probably damaging 1.00
R6448:Nfrkb UTSW 9 31394789 missense probably damaging 1.00
R6543:Nfrkb UTSW 9 31400985 nonsense probably null
R6612:Nfrkb UTSW 9 31397006 nonsense probably null
R7087:Nfrkb UTSW 9 31419932 nonsense probably null
R7123:Nfrkb UTSW 9 31414015 critical splice acceptor site probably null
R7483:Nfrkb UTSW 9 31414032 nonsense probably null
R7875:Nfrkb UTSW 9 31410154 missense possibly damaging 0.53
R7958:Nfrkb UTSW 9 31410154 missense possibly damaging 0.53
T0975:Nfrkb UTSW 9 31397083 missense probably benign 0.04
Z1088:Nfrkb UTSW 9 31411333 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GACATTTGCCTGGTCTTGC -3'
(R):5'- TGATGAAGGGACACTGGCTG -3'

Sequencing Primer
(F):5'- TGCTGATGACCAGTTTAGCAC -3'
(R):5'- TTGGCAGGGCTGTCAGC -3'
Posted On2015-04-30