Incidental Mutation 'R0386:Adamts13'
ID31274
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 038592-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0386 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 26986679 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]
Predicted Effect probably null
Transcript: ENSMUST00000014996
SMART Domains Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 2.3e-11 PFAM
Pfam:Reprolysin 84 291 1e-15 PFAM
Pfam:Reprolysin_3 113 237 2e-10 PFAM
Pfam:Reprolysin_2 132 281 5e-9 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102891
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
R8076:Adamts13 UTSW 2 26990612 missense probably benign 0.06
R8245:Adamts13 UTSW 2 26990556 missense probably damaging 1.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGACTTCCTTGCAACTCTGCC -3'
(R):5'- AGCGTCACTGAAGCTCCTGATATCC -3'

Sequencing Primer
(F):5'- AACTCTGCCCTTTCAGGAGATAC -3'
(R):5'- TGAAGCTCCTGATATCCGTATAACC -3'
Posted On2013-04-24