Incidental Mutation 'R4020:Mtrf1l'
ID312741
Institutional Source Beutler Lab
Gene Symbol Mtrf1l
Ensembl Gene ENSMUSG00000019774
Gene Namemitochondrial translational release factor 1-like
Synonyms9130004K12Rik
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4020 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location5811887-5823910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5817454 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 221 (T221A)
Ref Sequence ENSEMBL: ENSMUSP00000019908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019908]
Predicted Effect probably benign
Transcript: ENSMUST00000019908
AA Change: T221A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000019908
Gene: ENSMUSG00000019774
AA Change: T221A

DomainStartEndE-ValueType
PCRF 75 189 2.26e-36 SMART
Pfam:RF-1 221 331 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145718
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Mtrf1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Mtrf1l APN 10 5814180 splice site probably benign
IGL01292:Mtrf1l APN 10 5814090 missense probably benign 0.00
IGL01844:Mtrf1l APN 10 5814112 missense probably null 0.76
R0050:Mtrf1l UTSW 10 5815553 splice site silent
R0051:Mtrf1l UTSW 10 5813382 missense probably damaging 1.00
R0051:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R0866:Mtrf1l UTSW 10 5813376 missense probably damaging 1.00
R1636:Mtrf1l UTSW 10 5813265 missense probably damaging 0.98
R2897:Mtrf1l UTSW 10 5817565 missense probably benign 0.16
R4618:Mtrf1l UTSW 10 5817586 missense probably benign 0.37
R4843:Mtrf1l UTSW 10 5823696 missense possibly damaging 0.56
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6261:Mtrf1l UTSW 10 5815550 critical splice donor site probably null
R6345:Mtrf1l UTSW 10 5817468 missense possibly damaging 0.96
R6991:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R7669:Mtrf1l UTSW 10 5815620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGCACAAGGGAGACTTAC -3'
(R):5'- CTGTTTTCAAGGTGGCCTTAGAC -3'

Sequencing Primer
(F):5'- GGGAGACTTACAATGTCCATTTC -3'
(R):5'- TTAGACATGCGTCAGCCAG -3'
Posted On2015-04-30