Incidental Mutation 'R4020:Efcab5'
ID 312745
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R4020 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 77089915-77188968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 77104104 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1214 (V1214I)
Ref Sequence ENSEMBL: ENSMUSP00000104037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably benign
Transcript: ENSMUST00000108400
AA Change: V1214I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: V1214I

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117087
Predicted Effect probably benign
Transcript: ENSMUST00000130901
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151731
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
R8213:Efcab5 UTSW 11 77116071 missense probably damaging 1.00
R8690:Efcab5 UTSW 11 77103289 missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77121238 missense probably benign 0.03
R9310:Efcab5 UTSW 11 77113705 missense probably benign 0.23
R9324:Efcab5 UTSW 11 77113720 missense possibly damaging 0.95
R9404:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9405:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCATGTGTTTCCCAGCAGATG -3'
(R):5'- TGGAGAAACCCACATTGCC -3'

Sequencing Primer
(F):5'- TGCCTCTTACTGGAAGGCTAAAC -3'
(R):5'- GCCATTCCACTTCGCCAGAG -3'
Posted On 2015-04-30