Incidental Mutation 'R4020:Naip5'
ID 312755
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Naip-rs3, Lgn1
MMRRC Submission 040954-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4020 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 100348247-100382831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100359902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 445 (I445V)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably benign
Transcript: ENSMUST00000049789
AA Change: I445V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: I445V

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G C 8: 89,035,362 (GRCm39) V89L probably benign Het
Aebp2 T A 6: 140,588,021 (GRCm39) S364T probably damaging Het
Akr1b10 C T 6: 34,369,388 (GRCm39) T206I probably benign Het
Ap4e1 C T 2: 126,903,846 (GRCm39) S916F probably benign Het
Apob C T 12: 8,044,914 (GRCm39) Q845* probably null Het
Asb4 A G 6: 5,390,803 (GRCm39) probably benign Het
Bltp1 A G 3: 37,066,724 (GRCm39) probably benign Het
C1ra A T 6: 124,496,736 (GRCm39) T391S probably benign Het
Catsperg2 C A 7: 29,416,429 (GRCm39) D328Y probably damaging Het
Ciapin1 G T 8: 95,555,814 (GRCm39) L119M probably damaging Het
Crhr2 A G 6: 55,077,765 (GRCm39) probably benign Het
Cyp2j6 A G 4: 96,406,407 (GRCm39) S455P probably benign Het
Dctn4 G A 18: 60,671,329 (GRCm39) probably benign Het
Defa25 C T 8: 21,575,245 (GRCm39) R75C probably benign Het
Dnajc10 T C 2: 80,175,296 (GRCm39) L561P probably damaging Het
Dnajc7 A T 11: 100,482,292 (GRCm39) F185L probably damaging Het
Dock9 T C 14: 121,844,267 (GRCm39) I1175V probably benign Het
Drosha T G 15: 12,837,422 (GRCm39) L302R possibly damaging Het
Efcab5 C T 11: 76,994,930 (GRCm39) V1214I probably benign Het
Erich3 G A 3: 154,419,686 (GRCm39) R260H probably damaging Het
Fam168b T C 1: 34,867,860 (GRCm39) T47A possibly damaging Het
Gorasp1 G A 9: 119,757,936 (GRCm39) R290C probably benign Het
Gtf2a1 A G 12: 91,539,351 (GRCm39) S94P possibly damaging Het
Ighv1-53 C T 12: 115,122,442 (GRCm39) C5Y probably benign Het
Impdh1 T C 6: 29,202,693 (GRCm39) I446V probably benign Het
Krtap5-1 T C 7: 141,850,094 (GRCm39) probably null Het
Lipo3 T A 19: 33,764,804 (GRCm39) I17L probably benign Het
Lrrc37 A G 11: 103,506,119 (GRCm39) S1950P probably benign Het
Lss T C 10: 76,383,278 (GRCm39) M526T probably damaging Het
Med12l A C 3: 59,155,363 (GRCm39) Q1181P probably damaging Het
Mtrf1l T C 10: 5,767,454 (GRCm39) T221A probably benign Het
Muc21 T C 17: 35,930,953 (GRCm39) probably benign Het
Mxi1 C A 19: 53,360,160 (GRCm39) A294E probably benign Het
Nfrkb T A 9: 31,325,407 (GRCm39) L950Q possibly damaging Het
Nherf4 A T 9: 44,162,117 (GRCm39) probably null Het
Oplah A G 15: 76,181,476 (GRCm39) Y1155H probably damaging Het
Or5b105 T G 19: 13,079,790 (GRCm39) K287Q probably damaging Het
Pcnx1 C T 12: 81,965,018 (GRCm39) T395I probably damaging Het
Pitrm1 A G 13: 6,606,723 (GRCm39) H259R probably damaging Het
Pllp C A 8: 95,406,072 (GRCm39) M70I possibly damaging Het
Pop1 A G 15: 34,508,926 (GRCm39) T334A probably benign Het
Prep T C 10: 44,968,894 (GRCm39) probably benign Het
Ptprz1 C A 6: 22,959,623 (GRCm39) probably benign Het
Sbsn A G 7: 30,455,390 (GRCm39) S170G probably damaging Het
Sco1 T G 11: 66,954,846 (GRCm39) S284A probably benign Het
Slc25a10 T A 11: 120,388,265 (GRCm39) M227K probably damaging Het
Trav7-6 A G 14: 53,954,638 (GRCm39) K56R probably benign Het
Ubr4 T G 4: 139,179,116 (GRCm39) C3322G probably damaging Het
Unc5a T C 13: 55,151,182 (GRCm39) Y608H probably damaging Het
Zfand1 A C 3: 10,405,816 (GRCm39) N262K probably benign Het
Zfp335 C T 2: 164,743,380 (GRCm39) R536H probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100,382,683 (GRCm39) nonsense probably null
IGL00493:Naip5 APN 13 100,367,279 (GRCm39) missense probably damaging 0.96
IGL01294:Naip5 APN 13 100,353,588 (GRCm39) missense probably damaging 0.99
IGL01405:Naip5 APN 13 100,358,453 (GRCm39) missense probably benign 0.11
IGL01568:Naip5 APN 13 100,353,609 (GRCm39) missense probably benign 0.26
IGL01804:Naip5 APN 13 100,358,092 (GRCm39) missense probably damaging 1.00
IGL02012:Naip5 APN 13 100,359,847 (GRCm39) missense probably benign 0.01
IGL02183:Naip5 APN 13 100,358,150 (GRCm39) missense probably benign 0.41
IGL02449:Naip5 APN 13 100,358,683 (GRCm39) missense probably benign 0.34
IGL02815:Naip5 APN 13 100,359,239 (GRCm39) missense probably benign
IGL02992:Naip5 APN 13 100,359,536 (GRCm39) missense probably damaging 1.00
IGL03027:Naip5 APN 13 100,359,524 (GRCm39) missense probably benign 0.00
IGL03234:Naip5 APN 13 100,349,135 (GRCm39) missense probably damaging 1.00
inwood2 UTSW 13 100,359,522 (GRCm39) nonsense probably null
inwood3 UTSW 13 100,358,411 (GRCm39) nonsense probably null
Nuchal UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100,356,268 (GRCm39) missense probably benign 0.00
PIT4131001:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,359,622 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,351,158 (GRCm39) critical splice donor site probably null
R0462:Naip5 UTSW 13 100,358,240 (GRCm39) missense probably damaging 1.00
R0636:Naip5 UTSW 13 100,356,196 (GRCm39) missense probably benign
R0674:Naip5 UTSW 13 100,359,707 (GRCm39) missense probably benign 0.04
R0764:Naip5 UTSW 13 100,353,613 (GRCm39) missense probably benign 0.03
R0837:Naip5 UTSW 13 100,367,251 (GRCm39) missense probably benign
R1179:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R1302:Naip5 UTSW 13 100,358,099 (GRCm39) missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100,356,225 (GRCm39) missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100,358,714 (GRCm39) missense probably benign
R1638:Naip5 UTSW 13 100,349,177 (GRCm39) missense probably damaging 1.00
R1651:Naip5 UTSW 13 100,358,419 (GRCm39) missense probably benign 0.41
R1707:Naip5 UTSW 13 100,379,363 (GRCm39) missense probably damaging 1.00
R1835:Naip5 UTSW 13 100,359,726 (GRCm39) nonsense probably null
R1836:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.18
R1972:Naip5 UTSW 13 100,349,278 (GRCm39) missense probably damaging 0.98
R2080:Naip5 UTSW 13 100,358,041 (GRCm39) missense probably damaging 1.00
R2333:Naip5 UTSW 13 100,359,679 (GRCm39) missense probably damaging 1.00
R2348:Naip5 UTSW 13 100,356,246 (GRCm39) missense probably benign 0.01
R3055:Naip5 UTSW 13 100,358,386 (GRCm39) missense probably benign 0.23
R3401:Naip5 UTSW 13 100,358,411 (GRCm39) nonsense probably null
R3723:Naip5 UTSW 13 100,359,522 (GRCm39) nonsense probably null
R3775:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R3775:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4074:Naip5 UTSW 13 100,382,572 (GRCm39) missense probably damaging 1.00
R4082:Naip5 UTSW 13 100,382,338 (GRCm39) missense probably damaging 1.00
R4105:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R4227:Naip5 UTSW 13 100,349,276 (GRCm39) missense probably damaging 0.99
R4639:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4640:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4641:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4644:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4645:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4700:Naip5 UTSW 13 100,359,922 (GRCm39) missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100,358,378 (GRCm39) missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100,358,639 (GRCm39) missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100,356,189 (GRCm39) missense probably benign 0.32
R4816:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.01
R4816:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R4869:Naip5 UTSW 13 100,381,639 (GRCm39) missense probably damaging 1.00
R5162:Naip5 UTSW 13 100,359,914 (GRCm39) missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100,382,170 (GRCm39) missense probably benign 0.08
R5411:Naip5 UTSW 13 100,382,254 (GRCm39) missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100,367,170 (GRCm39) splice site probably null
R5760:Naip5 UTSW 13 100,379,346 (GRCm39) missense probably damaging 1.00
R5916:Naip5 UTSW 13 100,359,209 (GRCm39) missense probably benign 0.02
R6302:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100,359,913 (GRCm39) missense probably benign 0.01
R6474:Naip5 UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100,358,102 (GRCm39) missense probably benign
R6544:Naip5 UTSW 13 100,359,652 (GRCm39) missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100,382,437 (GRCm39) missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100,359,922 (GRCm39) missense probably damaging 0.99
R7052:Naip5 UTSW 13 100,358,855 (GRCm39) missense probably benign 0.01
R7138:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7141:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7375:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7375:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7401:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7401:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7447:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7447:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7466:Naip5 UTSW 13 100,358,494 (GRCm39) nonsense probably null
R7491:Naip5 UTSW 13 100,353,579 (GRCm39) missense probably benign 0.18
R7559:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7559:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7562:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7562:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7588:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7588:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7589:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7589:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7590:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7590:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7742:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7886:Naip5 UTSW 13 100,382,689 (GRCm39) missense probably benign 0.28
R7996:Naip5 UTSW 13 100,358,164 (GRCm39) missense probably damaging 1.00
R8026:Naip5 UTSW 13 100,382,406 (GRCm39) missense probably damaging 1.00
R8046:Naip5 UTSW 13 100,358,741 (GRCm39) missense probably benign
R8319:Naip5 UTSW 13 100,358,167 (GRCm39) missense probably benign 0.12
R8471:Naip5 UTSW 13 100,358,153 (GRCm39) missense probably damaging 0.99
R8480:Naip5 UTSW 13 100,358,743 (GRCm39) missense probably damaging 1.00
R8496:Naip5 UTSW 13 100,349,247 (GRCm39) missense probably benign 0.00
R8500:Naip5 UTSW 13 100,359,220 (GRCm39) missense probably damaging 0.98
R8712:Naip5 UTSW 13 100,359,604 (GRCm39) missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8781:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8788:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8817:Naip5 UTSW 13 100,349,207 (GRCm39) missense probably benign 0.01
R8833:Naip5 UTSW 13 100,359,442 (GRCm39) missense probably damaging 0.97
R8835:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8958:Naip5 UTSW 13 100,354,117 (GRCm39) nonsense probably null
R9031:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9032:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9074:Naip5 UTSW 13 100,358,264 (GRCm39) missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100,366,127 (GRCm39) missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100,359,008 (GRCm39) missense probably damaging 1.00
R9223:Naip5 UTSW 13 100,364,184 (GRCm39) missense probably benign 0.05
R9358:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9389:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9403:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9518:Naip5 UTSW 13 100,358,367 (GRCm39) missense probably benign
R9568:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9568:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9569:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9569:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9570:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9572:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9581:Naip5 UTSW 13 100,351,194 (GRCm39) missense probably benign 0.11
R9627:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9725:Naip5 UTSW 13 100,358,784 (GRCm39) missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9764:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9765:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGACCAGCTGGAACCTG -3'
(R):5'- GAGAGGTTCGAAGTGTACCACC -3'

Sequencing Primer
(F):5'- AGCTGGAACCTGTACAACAG -3'
(R):5'- GAGGTTCGAAGTGTACCACCCTATAC -3'
Posted On 2015-04-30