Incidental Mutation 'R4020:Drosha'
ID312757
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Namedrosha, ribonuclease type III
Synonyms1110013A17Rik, Rnasen, Etohi2
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4020 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location12824815-12935291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12837336 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 302 (L302R)
Ref Sequence ENSEMBL: ENSMUSP00000129279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090292
AA Change: L302R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: L302R

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156594
Predicted Effect possibly damaging
Transcript: ENSMUST00000169061
AA Change: L302R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: L302R

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198820
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R0918:Drosha UTSW 15 12842533 critical splice donor site probably null
R1473:Drosha UTSW 15 12912520 missense probably benign 0.04
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1526:Drosha UTSW 15 12913984 missense probably damaging 1.00
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5386:Drosha UTSW 15 12842121 missense probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5536:Drosha UTSW 15 12929711 missense possibly damaging 0.58
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R6920:Drosha UTSW 15 12834310 missense unknown
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7337:Drosha UTSW 15 12846199 missense possibly damaging 0.80
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7538:Drosha UTSW 15 12926243 missense probably damaging 1.00
R7559:Drosha UTSW 15 12842422 missense probably damaging 0.96
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGTGCCTGTCCGTCAGTAAC -3'
(R):5'- GAGGACACTTACCGAGACTGTC -3'

Sequencing Primer
(F):5'- CTGTCCGTCAGTAACTGAGGAG -3'
(R):5'- TTACCGAGACTGTCCTCCAACG -3'
Posted On2015-04-30