Incidental Mutation 'R4020:Oplah'
ID312759
Institutional Source Beutler Lab
Gene Symbol Oplah
Ensembl Gene ENSMUSG00000022562
Gene Name5-oxoprolinase (ATP-hydrolysing)
Synonyms
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4020 (G1)
Quality Score147
Status Validated
Chromosome15
Chromosomal Location76296601-76328015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76297276 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1155 (Y1155H)
Ref Sequence ENSEMBL: ENSMUSP00000129100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023222] [ENSMUST00000074173] [ENSMUST00000163991] [ENSMUST00000164189] [ENSMUST00000171192] [ENSMUST00000171340] [ENSMUST00000230221]
Predicted Effect probably damaging
Transcript: ENSMUST00000023222
AA Change: Y1155H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023222
Gene: ENSMUSG00000022562
AA Change: Y1155H

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 1.5e-63 PFAM
Pfam:Hydantoinase_A 231 531 6.4e-109 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 734 1256 5.2e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074173
SMART Domains Protein: ENSMUSP00000073805
Gene: ENSMUSG00000049653

DomainStartEndE-ValueType
Pfam:Speriolin_N 1 176 5.1e-67 PFAM
Pfam:Speriolin_N 172 262 1.2e-25 PFAM
Pfam:Speriolin_C 334 480 1.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163977
Predicted Effect probably benign
Transcript: ENSMUST00000163991
SMART Domains Protein: ENSMUSP00000134687
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Exo_endo_phos 176 471 4.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164189
SMART Domains Protein: ENSMUSP00000131967
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 9.8e-61 PFAM
Pfam:Hydantoinase_A 231 531 6.9e-103 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 853 2.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170261
Predicted Effect probably benign
Transcript: ENSMUST00000171192
SMART Domains Protein: ENSMUSP00000133693
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171340
AA Change: Y1155H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129100
Gene: ENSMUSG00000022562
AA Change: Y1155H

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 2.8e-60 PFAM
Pfam:Hydantoinase_A 231 531 6.6e-102 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 1260 8.2e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230735
Meta Mutation Damage Score 0.5353 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homodimer, using ATP hydrolysis to catalyze the conversion of 5-oxo-L-proline to L-glutamate. Defects in this gene are a cause of 5-oxoprolinase deficiency (OPLAHD). [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Oplah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Oplah APN 15 76305748 missense probably damaging 1.00
IGL01132:Oplah APN 15 76300957 missense probably benign 0.28
IGL02252:Oplah APN 15 76304764 missense probably damaging 1.00
IGL02493:Oplah APN 15 76300955 nonsense probably null
R0033:Oplah UTSW 15 76297134 missense probably benign 0.03
R0418:Oplah UTSW 15 76298487 missense probably benign 0.06
R0609:Oplah UTSW 15 76302992 missense probably benign 0.00
R1374:Oplah UTSW 15 76306555 missense probably damaging 0.99
R1419:Oplah UTSW 15 76297920 missense probably benign 0.41
R1703:Oplah UTSW 15 76296667 missense probably benign 0.02
R1733:Oplah UTSW 15 76302483 nonsense probably null
R1959:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1960:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1961:Oplah UTSW 15 76297464 missense probably damaging 1.00
R2290:Oplah UTSW 15 76302725 missense probably benign 0.00
R3552:Oplah UTSW 15 76302094 missense possibly damaging 0.78
R4019:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4207:Oplah UTSW 15 76302710 missense probably damaging 1.00
R4512:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4514:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4525:Oplah UTSW 15 76305509 missense probably damaging 1.00
R4803:Oplah UTSW 15 76302768 missense probably damaging 1.00
R5042:Oplah UTSW 15 76305709 nonsense probably null
R5259:Oplah UTSW 15 76301210 intron probably null
R5284:Oplah UTSW 15 76306559 missense probably benign 0.00
R5503:Oplah UTSW 15 76305446 critical splice donor site probably null
R5511:Oplah UTSW 15 76305744 missense possibly damaging 0.74
R5549:Oplah UTSW 15 76298266 missense probably damaging 0.98
R5594:Oplah UTSW 15 76296637 makesense probably null
R5631:Oplah UTSW 15 76305241 missense probably benign 0.01
R5849:Oplah UTSW 15 76297347 unclassified probably benign
R6776:Oplah UTSW 15 76300853 missense possibly damaging 0.94
R7105:Oplah UTSW 15 76297687 missense probably damaging 1.00
R7146:Oplah UTSW 15 76302660 missense probably benign
R7267:Oplah UTSW 15 76305009 missense probably benign 0.00
R7403:Oplah UTSW 15 76305009 missense probably benign 0.00
R7786:Oplah UTSW 15 76309716 missense possibly damaging 0.93
R8029:Oplah UTSW 15 76305696 missense probably benign
R8054:Oplah UTSW 15 76306257 missense probably benign 0.00
X0065:Oplah UTSW 15 76305163 nonsense probably null
Z1177:Oplah UTSW 15 76298487 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTAAGCCACGTGTACCAGGC -3'
(R):5'- CAATGTGACCCTGGGCAATG -3'

Sequencing Primer
(F):5'- AGGCTCTCCCCCTGTAGAAG -3'
(R):5'- CCGTATGGGCTACTATGAGAC -3'
Posted On2015-04-30