Incidental Mutation 'R4020:Dctn4'
ID312762
Institutional Source Beutler Lab
Gene Symbol Dctn4
Ensembl Gene ENSMUSG00000024603
Gene Namedynactin 4
Synonymsp62, 1110001K06Rik, 4930547K17Rik, C130039E17Rik
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4020 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location60526185-60558766 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 60538257 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025505] [ENSMUST00000223984]
Predicted Effect probably benign
Transcript: ENSMUST00000025505
SMART Domains Protein: ENSMUSP00000025505
Gene: ENSMUSG00000024603

DomainStartEndE-ValueType
Pfam:Dynactin_p62 23 172 4.8e-24 PFAM
Pfam:Dynactin_p62 125 378 8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223794
Predicted Effect probably benign
Transcript: ENSMUST00000223984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225005
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Olfr1458 T G 19: 13,102,426 K287Q probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Dctn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Dctn4 APN 18 60544130 missense probably benign 0.12
R0040:Dctn4 UTSW 18 60544042 missense possibly damaging 0.71
R1406:Dctn4 UTSW 18 60556330 missense probably benign
R1406:Dctn4 UTSW 18 60556330 missense probably benign
R1464:Dctn4 UTSW 18 60538406 missense probably damaging 0.97
R1464:Dctn4 UTSW 18 60538406 missense probably damaging 0.97
R1785:Dctn4 UTSW 18 60546335 critical splice donor site probably null
R1786:Dctn4 UTSW 18 60546335 critical splice donor site probably null
R2035:Dctn4 UTSW 18 60538417 missense possibly damaging 0.91
R2064:Dctn4 UTSW 18 60538277 missense possibly damaging 0.60
R4748:Dctn4 UTSW 18 60550236 missense probably damaging 1.00
R4786:Dctn4 UTSW 18 60555195 missense probably damaging 1.00
R4976:Dctn4 UTSW 18 60556392 missense probably benign 0.00
R5034:Dctn4 UTSW 18 60552884 missense probably benign 0.23
R5110:Dctn4 UTSW 18 60546315 missense probably damaging 0.96
R6210:Dctn4 UTSW 18 60546793 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAATTCCTAGAAGGCAGGCCC -3'
(R):5'- GATTTGTCTGCCATGCCCAC -3'

Sequencing Primer
(F):5'- GCAGGCCCCAAAAGCTCTTC -3'
(R):5'- GCCATGCCCACATCTCTAG -3'
Posted On2015-04-30