Incidental Mutation 'R4020:Olfr1458'
ID312763
Institutional Source Beutler Lab
Gene Symbol Olfr1458
Ensembl Gene ENSMUSG00000062844
Gene Nameolfactory receptor 1458
SynonymsEG667271, MOR202-24, GA_x6K02T2RE5P-3430689-3429787
MMRRC Submission 040954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4020 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13101593-13106775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13102426 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 287 (K287Q)
Ref Sequence ENSEMBL: ENSMUSP00000076019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076729] [ENSMUST00000207340] [ENSMUST00000208913] [ENSMUST00000214561] [ENSMUST00000215160] [ENSMUST00000215229]
Predicted Effect probably damaging
Transcript: ENSMUST00000076729
AA Change: K287Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076019
Gene: ENSMUSG00000062844
AA Change: K287Q

DomainStartEndE-ValueType
Pfam:7tm_4 23 300 7.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 27 297 1.2e-6 PFAM
Pfam:7tm_1 33 282 5.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207340
AA Change: K293Q
Predicted Effect probably benign
Transcript: ENSMUST00000208913
Predicted Effect probably benign
Transcript: ENSMUST00000214561
Predicted Effect probably damaging
Transcript: ENSMUST00000215160
AA Change: K293Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215229
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,575 probably benign Het
Adcy7 G C 8: 88,308,734 V89L probably benign Het
Aebp2 T A 6: 140,642,295 S364T probably damaging Het
Akr1b10 C T 6: 34,392,453 T206I probably benign Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Apob C T 12: 7,994,914 Q845* probably null Het
Asb4 A G 6: 5,390,803 probably benign Het
C1ra A T 6: 124,519,777 T391S probably benign Het
Catsperg2 C A 7: 29,717,004 D328Y probably damaging Het
Ciapin1 G T 8: 94,829,186 L119M probably damaging Het
Crhr2 A G 6: 55,100,780 probably benign Het
Cyp2j6 A G 4: 96,518,170 S455P probably benign Het
Dctn4 G A 18: 60,538,257 probably benign Het
Defa25 C T 8: 21,085,229 R75C probably benign Het
Dnajc10 T C 2: 80,344,952 L561P probably damaging Het
Dnajc7 A T 11: 100,591,466 F185L probably damaging Het
Dock9 T C 14: 121,606,855 I1175V probably benign Het
Drosha T G 15: 12,837,336 L302R possibly damaging Het
Efcab5 C T 11: 77,104,104 V1214I probably benign Het
Erich3 G A 3: 154,714,049 R260H probably damaging Het
Fam168b T C 1: 34,828,779 T47A possibly damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gm9573 T C 17: 35,620,061 probably benign Het
Gorasp1 G A 9: 119,928,870 R290C probably benign Het
Gtf2a1 A G 12: 91,572,577 S94P possibly damaging Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Impdh1 T C 6: 29,202,694 I446V probably benign Het
Krtap5-1 T C 7: 142,296,357 probably null Het
Lipo1 T A 19: 33,787,404 I17L probably benign Het
Lss T C 10: 76,547,444 M526T probably damaging Het
Med12l A C 3: 59,247,942 Q1181P probably damaging Het
Mtrf1l T C 10: 5,817,454 T221A probably benign Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nfrkb T A 9: 31,414,111 L950Q possibly damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Pitrm1 A G 13: 6,556,687 H259R probably damaging Het
Pllp C A 8: 94,679,444 M70I possibly damaging Het
Pop1 A G 15: 34,508,780 T334A probably benign Het
Prep T C 10: 45,092,798 probably benign Het
Ptprz1 C A 6: 22,959,624 probably benign Het
Sbsn A G 7: 30,755,965 S170G probably damaging Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Trav7-6 A G 14: 53,717,181 K56R probably benign Het
Ubr4 T G 4: 139,451,805 C3322G probably damaging Het
Unc5a T C 13: 55,003,369 Y608H probably damaging Het
Zfand1 A C 3: 10,340,756 N262K probably benign Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Other mutations in Olfr1458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Olfr1458 APN 19 13102989 missense possibly damaging 0.93
IGL02319:Olfr1458 APN 19 13102662 missense probably benign 0.14
IGL02926:Olfr1458 APN 19 13102823 missense possibly damaging 0.74
IGL03107:Olfr1458 APN 19 13103037 missense probably benign
IGL03304:Olfr1458 APN 19 13102741 missense probably damaging 1.00
R0046:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0049:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0099:Olfr1458 UTSW 19 13103140 missense probably benign 0.07
R0103:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0144:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0189:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0206:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0207:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0208:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0212:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0344:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0426:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0506:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0507:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0607:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0661:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0734:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1443:Olfr1458 UTSW 19 13103204 nonsense probably null
R1446:Olfr1458 UTSW 19 13103016 missense possibly damaging 0.59
R1567:Olfr1458 UTSW 19 13102642 missense probably benign 0.00
R2190:Olfr1458 UTSW 19 13102493 missense probably damaging 1.00
R2438:Olfr1458 UTSW 19 13102421 missense probably benign 0.00
R4406:Olfr1458 UTSW 19 13102594 missense possibly damaging 0.70
R4631:Olfr1458 UTSW 19 13103272 missense probably benign 0.07
R4847:Olfr1458 UTSW 19 13102534 missense probably damaging 1.00
R4979:Olfr1458 UTSW 19 13102689 missense probably damaging 0.97
R6086:Olfr1458 UTSW 19 13102381 makesense probably null
R6480:Olfr1458 UTSW 19 13102474 missense probably benign 0.34
R6484:Olfr1458 UTSW 19 13103067 missense probably benign 0.34
R6786:Olfr1458 UTSW 19 13103203 missense probably benign 0.09
R7121:Olfr1458 UTSW 19 13103173 missense probably benign 0.03
R7547:Olfr1458 UTSW 19 13103043 missense not run
R7822:Olfr1458 UTSW 19 13103053 missense probably benign 0.00
X0024:Olfr1458 UTSW 19 13103209 missense probably benign 0.22
X0027:Olfr1458 UTSW 19 13103224 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAAGCTGACACATTATTCCAGAG -3'
(R):5'- AGATGCATTCCAATTCAGGATATCGC -3'

Sequencing Primer
(F):5'- TTATTCCAGAGGAGAAGACATCAC -3'
(R):5'- TTCAGGATATCGCAAAGCTCTC -3'
Posted On2015-04-30