Incidental Mutation 'R3880:Itgav'
ID312770
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
MMRRC Submission 040794-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3880 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83768301 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 234 (V234A)
Ref Sequence ENSEMBL: ENSMUSP00000107369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]
Predicted Effect probably damaging
Transcript: ENSMUST00000028499
AA Change: V270A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: V270A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111740
AA Change: V234A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: V234A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Meta Mutation Damage Score 0.6124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,639,233 W872R probably damaging Het
Abcg3 T C 5: 104,938,180 probably benign Het
Adgrv1 T A 13: 81,435,705 Q4627L probably benign Het
Armc2 T C 10: 41,963,725 I415V possibly damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Bcas3 A G 11: 85,371,122 M107V probably benign Het
Ccdc43 T C 11: 102,692,203 probably null Het
Dtx4 A C 19: 12,486,456 S321A probably benign Het
Enox1 A T 14: 77,611,386 H379L possibly damaging Het
Evx1 A T 6: 52,313,861 D6V probably damaging Het
Fubp1 T A 3: 152,220,496 V286E probably damaging Het
Khdc3 T C 9: 73,103,590 S241P possibly damaging Het
Lipc T A 9: 70,820,518 I16F probably damaging Het
Mael T C 1: 166,236,868 probably benign Het
Myo7b T G 18: 31,969,514 E1487A probably damaging Het
Olfr622 T G 7: 103,639,624 K172T probably benign Het
Osgin1 A G 8: 119,441,452 H6R probably benign Het
Otog C T 7: 46,288,021 T1718I possibly damaging Het
Otogl T C 10: 107,827,704 E1002G probably damaging Het
Pkd1l1 T C 11: 8,961,983 N241S unknown Het
Psmd9 C T 5: 123,234,590 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc6a2 C A 8: 92,990,218 N337K probably damaging Het
Snx19 A T 9: 30,462,392 Q917L probably damaging Het
Srsf3 T C 17: 29,036,283 V14A probably damaging Het
Sspo G A 6: 48,494,940 V4729I probably benign Het
Syngap1 T A 17: 26,953,064 I82N probably damaging Het
Telo2 A T 17: 25,106,833 M407K probably damaging Het
Thsd7b G A 1: 129,595,370 G47D probably damaging Het
Tradd A T 8: 105,260,655 N6K possibly damaging Het
Trim30a C A 7: 104,411,189 C460F probably benign Het
Trip13 T C 13: 73,918,478 Y318C probably damaging Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Uggt1 A G 1: 36,176,804 probably benign Het
Wdr7 T A 18: 63,724,155 C101S possibly damaging Het
Zfp345 T C 2: 150,472,155 I487M possibly damaging Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R0554:Itgav UTSW 2 83794270 missense possibly damaging 0.95
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3766:Itgav UTSW 2 83801885 critical splice donor site probably null
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4287:Itgav UTSW 2 83724840 nonsense probably null
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6482:Itgav UTSW 2 83794270 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
R7429:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7430:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7522:Itgav UTSW 2 83802029 missense probably benign 0.10
R7546:Itgav UTSW 2 83776550 nonsense probably null
R7578:Itgav UTSW 2 83747875 missense probably benign 0.16
R8311:Itgav UTSW 2 83765777 missense probably damaging 1.00
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGCTGCTAACATCTACCTCTG -3'
(R):5'- GTCAAAGTTGAGTGTCTTCATCC -3'

Sequencing Primer
(F):5'- ACATCTACCTCTGTATTTGTAAGGC -3'
(R):5'- TGTCTCTACACAGCACCAGGG -3'
Posted On2015-04-30