Incidental Mutation 'R3880:Fubp1'
ID312773
Institutional Source Beutler Lab
Gene Symbol Fubp1
Ensembl Gene ENSMUSG00000028034
Gene Namefar upstream element (FUSE) binding protein 1
Synonyms9530027K12Rik, FBP, Fubp, Fubp4
MMRRC Submission 040794-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3880 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152210422-152236826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152220496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 286 (V286E)
Ref Sequence ENSEMBL: ENSMUSP00000143354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106121] [ENSMUST00000166984] [ENSMUST00000196062] [ENSMUST00000196429] [ENSMUST00000196695] [ENSMUST00000196739] [ENSMUST00000198227] [ENSMUST00000199202] [ENSMUST00000199876] [ENSMUST00000200452] [ENSMUST00000200524]
Predicted Effect probably damaging
Transcript: ENSMUST00000106121
AA Change: V285E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101727
Gene: ENSMUSG00000028034
AA Change: V285E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 571 599 1.3e-7 PFAM
Pfam:DUF1897 600 624 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166984
AA Change: V285E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130145
Gene: ENSMUSG00000028034
AA Change: V285E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196062
SMART Domains Protein: ENSMUSP00000143718
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 5e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196429
SMART Domains Protein: ENSMUSP00000143478
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
KH 1 69 1.1e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196695
AA Change: V286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143729
Gene: ENSMUSG00000028034
AA Change: V286E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 7e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.2e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.3e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.1e-4 PFAM
Pfam:DUF1897 601 625 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196739
AA Change: V286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143101
Gene: ENSMUSG00000028034
AA Change: V286E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 568 596 1e-7 PFAM
Pfam:DUF1897 597 629 4.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198227
AA Change: V285E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143370
Gene: ENSMUSG00000028034
AA Change: V285E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 94 164 6.9e-20 SMART
KH 179 251 1.5e-19 SMART
KH 269 339 8.1e-19 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 7.2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199199
Predicted Effect probably damaging
Transcript: ENSMUST00000199202
AA Change: V306E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143204
Gene: ENSMUSG00000028034
AA Change: V306E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 1e-8 PDB
KH 115 185 6.9e-20 SMART
KH 200 272 1.5e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199876
AA Change: V286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143618
Gene: ENSMUSG00000028034
AA Change: V286E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.5e-7 PFAM
Pfam:DUF1897 601 625 1.5e-9 PFAM
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199918
Predicted Effect probably benign
Transcript: ENSMUST00000200056
Predicted Effect probably damaging
Transcript: ENSMUST00000200452
AA Change: V285E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143019
Gene: ENSMUSG00000028034
AA Change: V285E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200524
AA Change: V286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143354
Gene: ENSMUSG00000028034
AA Change: V286E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 6.9e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.1e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.2e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 571 599 1.5e-4 PFAM
Pfam:DUF1897 600 632 7e-10 PFAM
Meta Mutation Damage Score 0.6209 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single stranded DNA-binding protein that binds to multiple DNA elements, including the far upstream element (FUSE) located upstream of c-myc. Binding to FUSE occurs on the non-coding strand, and is important to the regulation of c-myc in undifferentiated cells. This protein contains three domains, an amphipathic helix N-terminal domain, a DNA-binding central domain, and a C-terminal transactivation domain that contains three tyrosine-rich motifs. The N-terminal domain is thought to repress the activity of the C-terminal domain. This protein is also thought to bind RNA, and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. Aberrant expression of this gene has been found in malignant tissues, and this gene is important to neural system and lung development. Binding of this protein to viral RNA is thought to play a role in several viral diseases, including hepatitis C and hand, foot and mouth disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit pre- and perinatal lethality, cerebral hyperplasia, pale liver, hypoplastic lungs, spleen, thymus and bone marrow, cardiac hypertrophy, placental distress, small size, and anemia associated with variable, multilineage hematopoietic deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,639,233 W872R probably damaging Het
Abcg3 T C 5: 104,938,180 probably benign Het
Adgrv1 T A 13: 81,435,705 Q4627L probably benign Het
Armc2 T C 10: 41,963,725 I415V possibly damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Bcas3 A G 11: 85,371,122 M107V probably benign Het
Ccdc43 T C 11: 102,692,203 probably null Het
Dtx4 A C 19: 12,486,456 S321A probably benign Het
Enox1 A T 14: 77,611,386 H379L possibly damaging Het
Evx1 A T 6: 52,313,861 D6V probably damaging Het
Itgav T C 2: 83,768,301 V234A probably damaging Het
Khdc3 T C 9: 73,103,590 S241P possibly damaging Het
Lipc T A 9: 70,820,518 I16F probably damaging Het
Mael T C 1: 166,236,868 probably benign Het
Myo7b T G 18: 31,969,514 E1487A probably damaging Het
Olfr622 T G 7: 103,639,624 K172T probably benign Het
Osgin1 A G 8: 119,441,452 H6R probably benign Het
Otog C T 7: 46,288,021 T1718I possibly damaging Het
Otogl T C 10: 107,827,704 E1002G probably damaging Het
Pkd1l1 T C 11: 8,961,983 N241S unknown Het
Psmd9 C T 5: 123,234,590 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc6a2 C A 8: 92,990,218 N337K probably damaging Het
Snx19 A T 9: 30,462,392 Q917L probably damaging Het
Srsf3 T C 17: 29,036,283 V14A probably damaging Het
Sspo G A 6: 48,494,940 V4729I probably benign Het
Syngap1 T A 17: 26,953,064 I82N probably damaging Het
Telo2 A T 17: 25,106,833 M407K probably damaging Het
Thsd7b G A 1: 129,595,370 G47D probably damaging Het
Tradd A T 8: 105,260,655 N6K possibly damaging Het
Trim30a C A 7: 104,411,189 C460F probably benign Het
Trip13 T C 13: 73,918,478 Y318C probably damaging Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Uggt1 A G 1: 36,176,804 probably benign Het
Wdr7 T A 18: 63,724,155 C101S possibly damaging Het
Zfp345 T C 2: 150,472,155 I487M possibly damaging Het
Other mutations in Fubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Fubp1 APN 3 152222234 missense probably damaging 0.97
IGL01328:Fubp1 APN 3 152220218 missense probably damaging 1.00
IGL01583:Fubp1 APN 3 152215624 missense possibly damaging 0.71
IGL02886:Fubp1 APN 3 152220755 missense possibly damaging 0.90
R0166:Fubp1 UTSW 3 152220204 nonsense probably null
R0268:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0344:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0759:Fubp1 UTSW 3 152210637 small insertion probably benign
R1159:Fubp1 UTSW 3 152215592 missense possibly damaging 0.93
R1194:Fubp1 UTSW 3 152231969 frame shift probably null
R1687:Fubp1 UTSW 3 152228201 unclassified probably benign
R1818:Fubp1 UTSW 3 152222169 missense probably damaging 1.00
R4247:Fubp1 UTSW 3 152231936 missense possibly damaging 0.92
R4564:Fubp1 UTSW 3 152222936 nonsense probably null
R4776:Fubp1 UTSW 3 152222068 intron probably null
R4793:Fubp1 UTSW 3 152223329 missense possibly damaging 0.86
R4825:Fubp1 UTSW 3 152217890 splice site probably null
R5035:Fubp1 UTSW 3 152214851 missense probably benign 0.01
R5167:Fubp1 UTSW 3 152221352 missense possibly damaging 0.67
R5819:Fubp1 UTSW 3 152220553 missense probably damaging 1.00
R5892:Fubp1 UTSW 3 152218314 intron probably benign
R6254:Fubp1 UTSW 3 152232408 missense possibly damaging 0.66
R6814:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R6872:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R7132:Fubp1 UTSW 3 152232024 critical splice donor site probably null
R7612:Fubp1 UTSW 3 152218015 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACTTGGCTTAACATCATGTCCC -3'
(R):5'- ATCTGTGCTATCCTATCAGGTGTTG -3'

Sequencing Primer
(F):5'- GGCTTAACATCATGTCCCTTTTCTTG -3'
(R):5'- CAGGTGTTGTTCCATCATCTAAAAC -3'
Posted On2015-04-30