Incidental Mutation 'R3880:Psmd9'
ID 312776
Institutional Source Beutler Lab
Gene Symbol Psmd9
Ensembl Gene ENSMUSG00000029440
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Synonyms P27, Bridge-1, 1500011J20Rik
MMRRC Submission 040794-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R3880 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 123366253-123388189 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 123372653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100729] [ENSMUST00000197809]
AlphaFold Q9CR00
Predicted Effect probably benign
Transcript: ENSMUST00000100729
SMART Domains Protein: ENSMUSP00000098295
Gene: ENSMUSG00000029440

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Blast:PDZ 20 58 7e-7 BLAST
PDB:3WHL|H 23 99 2e-12 PDB
PDZ 121 195 5.02e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Predicted Effect probably benign
Transcript: ENSMUST00000197809
SMART Domains Protein: ENSMUSP00000143635
Gene: ENSMUSG00000029440

DomainStartEndE-ValueType
PDB:3WHL|H 1 53 9e-8 PDB
PDZ 75 148 1.5e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200560
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,584,959 (GRCm39) W872R probably damaging Het
Abcg3 T C 5: 105,086,046 (GRCm39) probably benign Het
Adgrv1 T A 13: 81,583,824 (GRCm39) Q4627L probably benign Het
Armc2 T C 10: 41,839,721 (GRCm39) I415V possibly damaging Het
Atp1b1 C T 1: 164,270,874 (GRCm39) R35H probably benign Het
Bcas3 A G 11: 85,261,948 (GRCm39) M107V probably benign Het
Ccdc43 T C 11: 102,583,029 (GRCm39) probably null Het
Dtx4 A C 19: 12,463,820 (GRCm39) S321A probably benign Het
Enox1 A T 14: 77,848,826 (GRCm39) H379L possibly damaging Het
Evx1 A T 6: 52,290,846 (GRCm39) D6V probably damaging Het
Fubp1 T A 3: 151,926,133 (GRCm39) V286E probably damaging Het
Itgav T C 2: 83,598,645 (GRCm39) V234A probably damaging Het
Khdc3 T C 9: 73,010,872 (GRCm39) S241P possibly damaging Het
Lipc T A 9: 70,727,800 (GRCm39) I16F probably damaging Het
Mael T C 1: 166,064,437 (GRCm39) probably benign Het
Myo7b T G 18: 32,102,567 (GRCm39) E1487A probably damaging Het
Or52a33 T G 7: 103,288,831 (GRCm39) K172T probably benign Het
Osgin1 A G 8: 120,168,191 (GRCm39) H6R probably benign Het
Otog C T 7: 45,937,445 (GRCm39) T1718I possibly damaging Het
Otogl T C 10: 107,663,565 (GRCm39) E1002G probably damaging Het
Pkd1l1 T C 11: 8,911,983 (GRCm39) N241S unknown Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Slc6a2 C A 8: 93,716,846 (GRCm39) N337K probably damaging Het
Snx19 A T 9: 30,373,688 (GRCm39) Q917L probably damaging Het
Srsf3 T C 17: 29,255,257 (GRCm39) V14A probably damaging Het
Sspo G A 6: 48,471,874 (GRCm39) V4729I probably benign Het
Syngap1 T A 17: 27,172,038 (GRCm39) I82N probably damaging Het
Telo2 A T 17: 25,325,807 (GRCm39) M407K probably damaging Het
Thsd7b G A 1: 129,523,107 (GRCm39) G47D probably damaging Het
Tradd A T 8: 105,987,287 (GRCm39) N6K possibly damaging Het
Trim30a C A 7: 104,060,396 (GRCm39) C460F probably benign Het
Trip13 T C 13: 74,066,597 (GRCm39) Y318C probably damaging Het
Ubfd1 T A 7: 121,667,999 (GRCm39) probably benign Het
Uggt1 A G 1: 36,215,885 (GRCm39) probably benign Het
Wdr7 T A 18: 63,857,226 (GRCm39) C101S possibly damaging Het
Zfp345 T C 2: 150,314,075 (GRCm39) I487M possibly damaging Het
Other mutations in Psmd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Psmd9 APN 5 123,372,697 (GRCm39) missense probably damaging 0.99
IGL02354:Psmd9 APN 5 123,386,379 (GRCm39) missense probably damaging 1.00
IGL02361:Psmd9 APN 5 123,386,379 (GRCm39) missense probably damaging 1.00
IGL02947:Psmd9 APN 5 123,384,278 (GRCm39) missense probably benign 0.01
R0318:Psmd9 UTSW 5 123,372,712 (GRCm39) missense possibly damaging 0.58
R1491:Psmd9 UTSW 5 123,366,410 (GRCm39) missense probably benign
R1598:Psmd9 UTSW 5 123,379,980 (GRCm39) missense probably damaging 1.00
R2024:Psmd9 UTSW 5 123,379,925 (GRCm39) missense probably damaging 1.00
R3811:Psmd9 UTSW 5 123,372,653 (GRCm39) unclassified probably benign
R3816:Psmd9 UTSW 5 123,372,653 (GRCm39) unclassified probably benign
R3879:Psmd9 UTSW 5 123,372,653 (GRCm39) unclassified probably benign
R8004:Psmd9 UTSW 5 123,379,998 (GRCm39) critical splice donor site probably null
R8143:Psmd9 UTSW 5 123,366,479 (GRCm39) missense probably damaging 1.00
R9337:Psmd9 UTSW 5 123,386,387 (GRCm39) missense probably damaging 1.00
R9758:Psmd9 UTSW 5 123,372,745 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACTGGTACCCACTGCAG -3'
(R):5'- AGCAGAAAAGCTTTGCAGTGC -3'

Sequencing Primer
(F):5'- CCCACTGCAGAGGGTAGCTATAAG -3'
(R):5'- AAGCTTTGCAGTGCTCAATG -3'
Posted On 2015-04-30