Incidental Mutation 'R3880:Lipc'
ID312789
Institutional Source Beutler Lab
Gene Symbol Lipc
Ensembl Gene ENSMUSG00000032207
Gene Namelipase, hepatic
SynonymsHpl, HL
MMRRC Submission 040794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R3880 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70798128-70952226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70820518 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 16 (I16F)
Ref Sequence ENSEMBL: ENSMUSP00000149185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000214995] [ENSMUST00000216798]
Predicted Effect probably damaging
Transcript: ENSMUST00000034731
AA Change: I101F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: I101F

DomainStartEndE-ValueType
Pfam:Lipase 14 350 1.1e-136 PFAM
LH2 353 488 4.62e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215814
Predicted Effect probably damaging
Transcript: ENSMUST00000216798
AA Change: I16F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.7869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,639,233 W872R probably damaging Het
Abcg3 T C 5: 104,938,180 probably benign Het
Adgrv1 T A 13: 81,435,705 Q4627L probably benign Het
Armc2 T C 10: 41,963,725 I415V possibly damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Bcas3 A G 11: 85,371,122 M107V probably benign Het
Ccdc43 T C 11: 102,692,203 probably null Het
Dtx4 A C 19: 12,486,456 S321A probably benign Het
Enox1 A T 14: 77,611,386 H379L possibly damaging Het
Evx1 A T 6: 52,313,861 D6V probably damaging Het
Fubp1 T A 3: 152,220,496 V286E probably damaging Het
Itgav T C 2: 83,768,301 V234A probably damaging Het
Khdc3 T C 9: 73,103,590 S241P possibly damaging Het
Mael T C 1: 166,236,868 probably benign Het
Myo7b T G 18: 31,969,514 E1487A probably damaging Het
Olfr622 T G 7: 103,639,624 K172T probably benign Het
Osgin1 A G 8: 119,441,452 H6R probably benign Het
Otog C T 7: 46,288,021 T1718I possibly damaging Het
Otogl T C 10: 107,827,704 E1002G probably damaging Het
Pkd1l1 T C 11: 8,961,983 N241S unknown Het
Psmd9 C T 5: 123,234,590 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc6a2 C A 8: 92,990,218 N337K probably damaging Het
Snx19 A T 9: 30,462,392 Q917L probably damaging Het
Srsf3 T C 17: 29,036,283 V14A probably damaging Het
Sspo G A 6: 48,494,940 V4729I probably benign Het
Syngap1 T A 17: 26,953,064 I82N probably damaging Het
Telo2 A T 17: 25,106,833 M407K probably damaging Het
Thsd7b G A 1: 129,595,370 G47D probably damaging Het
Tradd A T 8: 105,260,655 N6K possibly damaging Het
Trim30a C A 7: 104,411,189 C460F probably benign Het
Trip13 T C 13: 73,918,478 Y318C probably damaging Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Uggt1 A G 1: 36,176,804 probably benign Het
Wdr7 T A 18: 63,724,155 C101S possibly damaging Het
Zfp345 T C 2: 150,472,155 I487M possibly damaging Het
Other mutations in Lipc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lipc APN 9 70820437 missense possibly damaging 0.56
IGL02431:Lipc APN 9 70934468 intron probably benign
Immunobolic UTSW 9 70823386 missense probably damaging 1.00
R0112:Lipc UTSW 9 70820427 missense probably damaging 1.00
R0114:Lipc UTSW 9 70803781 missense probably damaging 0.99
R0545:Lipc UTSW 9 70812705 missense probably damaging 1.00
R1051:Lipc UTSW 9 70802116 missense probably benign 0.00
R1069:Lipc UTSW 9 70823537 missense probably benign 0.03
R1350:Lipc UTSW 9 70798367 missense probably benign 0.00
R1742:Lipc UTSW 9 70820529 missense probably damaging 1.00
R2145:Lipc UTSW 9 70934535 missense possibly damaging 0.94
R4360:Lipc UTSW 9 70852582 intron probably benign
R4999:Lipc UTSW 9 70816731 missense probably benign 0.00
R5159:Lipc UTSW 9 70812910 missense probably benign 0.03
R5197:Lipc UTSW 9 70798391 missense probably benign 0.11
R5458:Lipc UTSW 9 70852582 intron probably benign
R5710:Lipc UTSW 9 70812697 missense probably benign 0.30
R6645:Lipc UTSW 9 70803748 missense probably damaging 1.00
R6749:Lipc UTSW 9 70823386 missense probably damaging 1.00
R6849:Lipc UTSW 9 70818847 critical splice donor site probably null
R7011:Lipc UTSW 9 70818954 missense probably benign 0.09
R7346:Lipc UTSW 9 70812747 missense probably damaging 1.00
R7426:Lipc UTSW 9 70802168 missense probably benign 0.21
R7587:Lipc UTSW 9 70818924 missense probably damaging 1.00
R7830:Lipc UTSW 9 70812901 missense probably damaging 1.00
R8269:Lipc UTSW 9 70820373 missense probably damaging 1.00
X0054:Lipc UTSW 9 70812748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGAGGCCTCATATCTGC -3'
(R):5'- AGCACGAGGAGGTCTTTCTG -3'

Sequencing Primer
(F):5'- ACTTGCAGTCTGGGCACTG -3'
(R):5'- TTCTGGTGGGGAGAAAGATCTAGC -3'
Posted On2015-04-30