Incidental Mutation 'R3880:Telo2'
ID312798
Institutional Source Beutler Lab
Gene Symbol Telo2
Ensembl Gene ENSMUSG00000024170
Gene Nametelomere maintenance 2
Synonyms1200003M09Rik
MMRRC Submission 040794-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3880 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25099570-25115967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25106833 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 407 (M407K)
Ref Sequence ENSEMBL: ENSMUSP00000110835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024987] [ENSMUST00000115181]
Predicted Effect probably damaging
Transcript: ENSMUST00000024987
AA Change: M407K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170
AA Change: M407K

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115181
AA Change: M407K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170
AA Change: M407K

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156698
Meta Mutation Damage Score 0.8882 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as an S-phase checkpoint protein in the cell cycle. The protein may also play a role in DNA repair.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,639,233 W872R probably damaging Het
Abcg3 T C 5: 104,938,180 probably benign Het
Adgrv1 T A 13: 81,435,705 Q4627L probably benign Het
Armc2 T C 10: 41,963,725 I415V possibly damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Bcas3 A G 11: 85,371,122 M107V probably benign Het
Ccdc43 T C 11: 102,692,203 probably null Het
Dtx4 A C 19: 12,486,456 S321A probably benign Het
Enox1 A T 14: 77,611,386 H379L possibly damaging Het
Evx1 A T 6: 52,313,861 D6V probably damaging Het
Fubp1 T A 3: 152,220,496 V286E probably damaging Het
Itgav T C 2: 83,768,301 V234A probably damaging Het
Khdc3 T C 9: 73,103,590 S241P possibly damaging Het
Lipc T A 9: 70,820,518 I16F probably damaging Het
Mael T C 1: 166,236,868 probably benign Het
Myo7b T G 18: 31,969,514 E1487A probably damaging Het
Olfr622 T G 7: 103,639,624 K172T probably benign Het
Osgin1 A G 8: 119,441,452 H6R probably benign Het
Otog C T 7: 46,288,021 T1718I possibly damaging Het
Otogl T C 10: 107,827,704 E1002G probably damaging Het
Pkd1l1 T C 11: 8,961,983 N241S unknown Het
Psmd9 C T 5: 123,234,590 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc6a2 C A 8: 92,990,218 N337K probably damaging Het
Snx19 A T 9: 30,462,392 Q917L probably damaging Het
Srsf3 T C 17: 29,036,283 V14A probably damaging Het
Sspo G A 6: 48,494,940 V4729I probably benign Het
Syngap1 T A 17: 26,953,064 I82N probably damaging Het
Thsd7b G A 1: 129,595,370 G47D probably damaging Het
Tradd A T 8: 105,260,655 N6K possibly damaging Het
Trim30a C A 7: 104,411,189 C460F probably benign Het
Trip13 T C 13: 73,918,478 Y318C probably damaging Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Uggt1 A G 1: 36,176,804 probably benign Het
Wdr7 T A 18: 63,724,155 C101S possibly damaging Het
Zfp345 T C 2: 150,472,155 I487M possibly damaging Het
Other mutations in Telo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Telo2 APN 17 25100129 splice site probably benign
IGL01398:Telo2 APN 17 25105774 missense probably benign 0.00
IGL01878:Telo2 APN 17 25101358 missense probably benign 0.19
IGL02728:Telo2 APN 17 25104654 missense probably damaging 1.00
R0669:Telo2 UTSW 17 25105823 missense probably benign 0.01
R0671:Telo2 UTSW 17 25113165 missense probably benign 0.00
R1783:Telo2 UTSW 17 25102738 splice site probably null
R1869:Telo2 UTSW 17 25114994 missense probably benign 0.32
R1988:Telo2 UTSW 17 25101668 missense probably benign 0.04
R2018:Telo2 UTSW 17 25105408 missense probably damaging 1.00
R2167:Telo2 UTSW 17 25110818 missense probably benign
R2219:Telo2 UTSW 17 25103699 missense probably benign 0.00
R3421:Telo2 UTSW 17 25110752 missense probably damaging 0.99
R4190:Telo2 UTSW 17 25102013 missense probably benign 0.00
R4299:Telo2 UTSW 17 25115256 missense possibly damaging 0.94
R4574:Telo2 UTSW 17 25101673 missense probably damaging 1.00
R4600:Telo2 UTSW 17 25105148 missense possibly damaging 0.79
R6010:Telo2 UTSW 17 25104878 missense possibly damaging 0.79
R6185:Telo2 UTSW 17 25102040 missense probably benign 0.29
R6513:Telo2 UTSW 17 25101412 missense probably damaging 1.00
R7352:Telo2 UTSW 17 25102069 missense probably damaging 1.00
R7538:Telo2 UTSW 17 25110821 missense probably benign 0.08
R8347:Telo2 UTSW 17 25104637 nonsense probably null
R8754:Telo2 UTSW 17 25102067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACTCCTCAATCCCAGATCCTG -3'
(R):5'- AGTGTTACATCAGCAAGGCC -3'

Sequencing Primer
(F):5'- CCTGGAAATGTGGGGTCCTAGAC -3'
(R):5'- TGTCTGCCTGGCACACC -3'
Posted On2015-04-30