Mutagenetix > Incidental Mutations

Incidental Mutation 'R3880:Dtx4'

312803

Institutional Source

Beutler Lab

Gene Symbol

Dtx4

Ensembl Gene

ENSMUSG00000039982

Gene Name

deltex 4, E3 ubiquitin ligase

Synonyms

RNF155

MMRRC Submission

040794-MU

Accession Numbers

Genbank: NM_001047855

Is this an essential gene?

Possibly non essential (E-score: 0.399) question?

Stock #

R3880 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12466341-12501996 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 12486456 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 321 (S321A)

Ref Sequence

ENSEMBL: ENSMUSP00000040229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045521]

AlphaFold

Q6PDK8

Predicted Effect

probably benign
Transcript: ENSMUST00000045521
AA Change: S321A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: S321A

Domain	Start	End	E-Value	Type
WWE	5	86	1.38e-38	SMART
WWE	88	163	6.72e-28	SMART
low complexity region	175	192	N/A	INTRINSIC
low complexity region	372	386	N/A	INTRINSIC
RING	406	464	2.2e-6	SMART
Blast:RING	510	532	3e-7	BLAST

Meta Mutation Damage Score

0.0731

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

92% (35/38)

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,639,233	W872R	probably damaging	Het
Abcg3	T	C	5: 104,938,180		probably benign	Het
Adgrv1	T	A	13: 81,435,705	Q4627L	probably benign	Het
Armc2	T	C	10: 41,963,725	I415V	possibly damaging	Het
Atp1b1	C	T	1: 164,443,305	R35H	probably benign	Het
Bcas3	A	G	11: 85,371,122	M107V	probably benign	Het
Ccdc43	T	C	11: 102,692,203		probably null	Het
Enox1	A	T	14: 77,611,386	H379L	possibly damaging	Het
Evx1	A	T	6: 52,313,861	D6V	probably damaging	Het
Fubp1	T	A	3: 152,220,496	V286E	probably damaging	Het
Itgav	T	C	2: 83,768,301	V234A	probably damaging	Het
Khdc3	T	C	9: 73,103,590	S241P	possibly damaging	Het
Lipc	T	A	9: 70,820,518	I16F	probably damaging	Het
Mael	T	C	1: 166,236,868		probably benign	Het
Myo7b	T	G	18: 31,969,514	E1487A	probably damaging	Het
Olfr622	T	G	7: 103,639,624	K172T	probably benign	Het
Osgin1	A	G	8: 119,441,452	H6R	probably benign	Het
Otog	C	T	7: 46,288,021	T1718I	possibly damaging	Het
Otogl	T	C	10: 107,827,704	E1002G	probably damaging	Het
Pkd1l1	T	C	11: 8,961,983	N241S	unknown	Het
Psmd9	C	T	5: 123,234,590		probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Slc6a2	C	A	8: 92,990,218	N337K	probably damaging	Het
Snx19	A	T	9: 30,462,392	Q917L	probably damaging	Het
Srsf3	T	C	17: 29,036,283	V14A	probably damaging	Het
Sspo	G	A	6: 48,494,940	V4729I	probably benign	Het
Syngap1	T	A	17: 26,953,064	I82N	probably damaging	Het
Telo2	A	T	17: 25,106,833	M407K	probably damaging	Het
Thsd7b	G	A	1: 129,595,370	G47D	probably damaging	Het
Tradd	A	T	8: 105,260,655	N6K	possibly damaging	Het
Trim30a	C	A	7: 104,411,189	C460F	probably benign	Het
Trip13	T	C	13: 73,918,478	Y318C	probably damaging	Het
Ubfd1	T	A	7: 122,068,776		probably benign	Het
Uggt1	A	G	1: 36,176,804		probably benign	Het
Wdr7	T	A	18: 63,724,155	C101S	possibly damaging	Het
Zfp345	T	C	2: 150,472,155	I487M	possibly damaging	Het

Other mutations in Dtx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01533:Dtx4	APN	19	12478215	missense	possibly damaging	0.88
IGL02173:Dtx4	APN	19	12473257	nonsense	probably null
IGL03127:Dtx4	APN	19	12486500	splice site	probably benign
G5030:Dtx4	UTSW	19	12469579	missense	probably benign	0.07
R0143:Dtx4	UTSW	19	12486482	missense	probably damaging	0.98
R0932:Dtx4	UTSW	19	12492151	missense	probably benign
R1066:Dtx4	UTSW	19	12501009	missense	probably damaging	0.98
R2155:Dtx4	UTSW	19	12485282	nonsense	probably null
R2182:Dtx4	UTSW	19	12483107	missense	probably null	0.75
R2362:Dtx4	UTSW	19	12492535	missense	probably damaging	1.00
R4108:Dtx4	UTSW	19	12501123	missense	probably damaging	0.96
R4361:Dtx4	UTSW	19	12485296	missense	probably benign	0.04
R4943:Dtx4	UTSW	19	12501060	missense	probably damaging	1.00
R5361:Dtx4	UTSW	19	12485262	critical splice donor site	probably null
R5440:Dtx4	UTSW	19	12492317	missense	probably damaging	1.00
R5613:Dtx4	UTSW	19	12485403	missense	probably damaging	0.97
R5614:Dtx4	UTSW	19	12482183	missense	probably damaging	1.00
R5703:Dtx4	UTSW	19	12482210	missense	possibly damaging	0.84
R5994:Dtx4	UTSW	19	12501153	missense	probably damaging	1.00
R6695:Dtx4	UTSW	19	12473235	nonsense	probably null
R7107:Dtx4	UTSW	19	12473260	nonsense	probably null
R7208:Dtx4	UTSW	19	12482073	critical splice donor site	probably null
R7231:Dtx4	UTSW	19	12469658	nonsense	probably null
R7521:Dtx4	UTSW	19	12492497	missense	probably benign	0.30
R7609:Dtx4	UTSW	19	12492281	missense	probably damaging	1.00
R7721:Dtx4	UTSW	19	12482136	missense	probably benign	0.09
R7775:Dtx4	UTSW	19	12492010	missense	probably benign	0.02
R8685:Dtx4	UTSW	19	12469631	missense	probably benign	0.36
Z1176:Dtx4	UTSW	19	12491909	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTTAGCACCACCCACTGAG -3'
(R):5'- CTCTGATCATGGCTGAAGATCTG -3'

Sequencing Primer
(F):5'- TAGCACCACCCACTGAGCTTTC -3'
(R):5'- CGACATTTTCCAAAGGTGCG -3'

Posted On

2015-04-30