Incidental Mutation 'R3880:Dtx4'
ID 312803
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission 040794-MU
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R3880 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 12486456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 321 (S321A)
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521]
AlphaFold Q6PDK8
Predicted Effect probably benign
Transcript: ENSMUST00000045521
AA Change: S321A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: S321A

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 92% (35/38)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,639,233 W872R probably damaging Het
Abcg3 T C 5: 104,938,180 probably benign Het
Adgrv1 T A 13: 81,435,705 Q4627L probably benign Het
Armc2 T C 10: 41,963,725 I415V possibly damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Bcas3 A G 11: 85,371,122 M107V probably benign Het
Ccdc43 T C 11: 102,692,203 probably null Het
Enox1 A T 14: 77,611,386 H379L possibly damaging Het
Evx1 A T 6: 52,313,861 D6V probably damaging Het
Fubp1 T A 3: 152,220,496 V286E probably damaging Het
Itgav T C 2: 83,768,301 V234A probably damaging Het
Khdc3 T C 9: 73,103,590 S241P possibly damaging Het
Lipc T A 9: 70,820,518 I16F probably damaging Het
Mael T C 1: 166,236,868 probably benign Het
Myo7b T G 18: 31,969,514 E1487A probably damaging Het
Olfr622 T G 7: 103,639,624 K172T probably benign Het
Osgin1 A G 8: 119,441,452 H6R probably benign Het
Otog C T 7: 46,288,021 T1718I possibly damaging Het
Otogl T C 10: 107,827,704 E1002G probably damaging Het
Pkd1l1 T C 11: 8,961,983 N241S unknown Het
Psmd9 C T 5: 123,234,590 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc6a2 C A 8: 92,990,218 N337K probably damaging Het
Snx19 A T 9: 30,462,392 Q917L probably damaging Het
Srsf3 T C 17: 29,036,283 V14A probably damaging Het
Sspo G A 6: 48,494,940 V4729I probably benign Het
Syngap1 T A 17: 26,953,064 I82N probably damaging Het
Telo2 A T 17: 25,106,833 M407K probably damaging Het
Thsd7b G A 1: 129,595,370 G47D probably damaging Het
Tradd A T 8: 105,260,655 N6K possibly damaging Het
Trim30a C A 7: 104,411,189 C460F probably benign Het
Trip13 T C 13: 73,918,478 Y318C probably damaging Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Uggt1 A G 1: 36,176,804 probably benign Het
Wdr7 T A 18: 63,724,155 C101S possibly damaging Het
Zfp345 T C 2: 150,472,155 I487M possibly damaging Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R1066:Dtx4 UTSW 19 12501009 missense probably damaging 0.98
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2182:Dtx4 UTSW 19 12483107 missense probably null 0.75
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4361:Dtx4 UTSW 19 12485296 missense probably benign 0.04
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5361:Dtx4 UTSW 19 12485262 critical splice donor site probably null
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5703:Dtx4 UTSW 19 12482210 missense possibly damaging 0.84
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7521:Dtx4 UTSW 19 12492497 missense probably benign 0.30
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
R8685:Dtx4 UTSW 19 12469631 missense probably benign 0.36
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTAGCACCACCCACTGAG -3'
(R):5'- CTCTGATCATGGCTGAAGATCTG -3'

Sequencing Primer
(F):5'- TAGCACCACCCACTGAGCTTTC -3'
(R):5'- CGACATTTTCCAAAGGTGCG -3'
Posted On 2015-04-30