Incidental Mutation 'R3882:Kif18a'
ID312806
Institutional Source Beutler Lab
Gene Symbol Kif18a
Ensembl Gene ENSMUSG00000027115
Gene Namekinesin family member 18A
SynonymsB130001M12Rik, N-8 kinesin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3882 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109280738-109341747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109306974 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 517 (N517S)
Ref Sequence ENSEMBL: ENSMUSP00000028527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028527]
Predicted Effect probably benign
Transcript: ENSMUST00000028527
AA Change: N517S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: N517S

DomainStartEndE-ValueType
KISc 9 363 8.91e-158 SMART
Blast:KISc 382 433 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151395
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,700 W24R probably damaging Het
Acy1 G T 9: 106,435,509 T181K possibly damaging Het
Adcy4 A G 14: 55,774,546 F581L probably benign Het
Amhr2 G A 15: 102,445,898 G48D probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgef17 A G 7: 100,876,454 F1979S possibly damaging Het
C2 T C 17: 34,873,489 T191A probably benign Het
Cmya5 T A 13: 93,091,219 T2454S probably benign Het
Dstn A G 2: 143,942,187 E150G probably benign Het
Dync1h1 G T 12: 110,629,058 V1444F probably benign Het
Eif3f T C 7: 108,940,955 V319A possibly damaging Het
Gpha2 T C 19: 6,226,889 probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Jup A G 11: 100,378,381 V402A probably benign Het
Kif20b T A 19: 34,950,080 I874N probably damaging Het
Lepr T A 4: 101,815,265 V1162E probably damaging Het
Man2a2 A T 7: 80,362,315 V698D possibly damaging Het
Miip A C 4: 147,861,052 S376A possibly damaging Het
Nsun7 G A 5: 66,278,640 R285Q probably damaging Het
Nup210l T C 3: 90,124,210 V281A probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha8 A G 18: 36,993,571 I369V probably benign Het
Pcdha8 C A 18: 36,993,046 L194I probably damaging Het
Pcdhga10 C A 18: 37,747,441 A85E possibly damaging Het
Ppfibp1 A G 6: 146,998,221 R137G possibly damaging Het
Rcor1 C T 12: 111,103,753 A230V probably damaging Het
Scn3a T C 2: 65,482,279 M1191V probably benign Het
Skor2 A G 18: 76,862,689 D904G probably damaging Het
Suco A T 1: 161,834,744 V706E probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn1r83 A T 7: 12,321,402 C243S probably damaging Het
Wdr17 A T 8: 54,639,501 C1083S possibly damaging Het
Zfp952 G T 17: 33,001,975 E18* probably null Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Zscan25 G T 5: 145,291,052 G509C probably damaging Het
Other mutations in Kif18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif18a APN 2 109317988 missense possibly damaging 0.93
IGL00795:Kif18a APN 2 109293020 missense probably damaging 1.00
IGL00904:Kif18a APN 2 109292126 missense probably damaging 1.00
IGL00990:Kif18a APN 2 109334422 missense probably benign 0.01
IGL01323:Kif18a APN 2 109298442 missense probably benign 0.02
IGL01382:Kif18a APN 2 109296766 nonsense probably null
IGL02205:Kif18a APN 2 109307018 splice site probably benign
IGL02207:Kif18a APN 2 109296707 missense probably damaging 0.99
IGL02970:Kif18a APN 2 109287888 missense probably damaging 1.00
IGL03087:Kif18a APN 2 109318117 splice site probably benign
R0030:Kif18a UTSW 2 109333318 missense probably benign
R0482:Kif18a UTSW 2 109287843 start codon destroyed probably null 1.00
R0631:Kif18a UTSW 2 109298322 splice site probably benign
R1597:Kif18a UTSW 2 109292991 missense probably damaging 1.00
R1640:Kif18a UTSW 2 109289816 missense probably benign 0.25
R1675:Kif18a UTSW 2 109298403 missense probably benign
R1723:Kif18a UTSW 2 109302882 missense probably damaging 1.00
R2141:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2142:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2243:Kif18a UTSW 2 109298107 missense probably damaging 1.00
R3609:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3611:Kif18a UTSW 2 109338596 missense probably benign 0.02
R4292:Kif18a UTSW 2 109298126 missense probably damaging 0.99
R4293:Kif18a UTSW 2 109293053 missense probably benign
R4294:Kif18a UTSW 2 109293053 missense probably benign
R4295:Kif18a UTSW 2 109293053 missense probably benign
R4428:Kif18a UTSW 2 109288121 missense probably damaging 1.00
R4791:Kif18a UTSW 2 109287875 missense probably benign 0.16
R4819:Kif18a UTSW 2 109292126 missense probably damaging 1.00
R5078:Kif18a UTSW 2 109295142 splice site probably benign
R5175:Kif18a UTSW 2 109302978 splice site probably null
R5319:Kif18a UTSW 2 109318025 missense probably benign 0.00
R5821:Kif18a UTSW 2 109289845 splice site probably benign
R5966:Kif18a UTSW 2 109292066 missense probably damaging 1.00
R6886:Kif18a UTSW 2 109296663 missense probably damaging 1.00
R7069:Kif18a UTSW 2 109295002 missense probably damaging 0.99
R7765:Kif18a UTSW 2 109306940 missense probably benign 0.00
R7801:Kif18a UTSW 2 109287845 missense probably damaging 0.99
R7834:Kif18a UTSW 2 109296774 missense probably damaging 1.00
R8442:Kif18a UTSW 2 109294973 missense possibly damaging 0.68
R8510:Kif18a UTSW 2 109296764 missense probably damaging 1.00
Z1176:Kif18a UTSW 2 109318053 missense possibly damaging 0.63
Z1177:Kif18a UTSW 2 109294957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTAACATAATGAACCATGCC -3'
(R):5'- AGTAGTCTGAAATAGAGACGGTTAC -3'

Sequencing Primer
(F):5'- TGAACCATGCCAGCATAAGAAAATG -3'
(R):5'- TGAGCCTTTTGAAAATAGAAACCAC -3'
Posted On2015-04-30