Incidental Mutation 'R3882:Dstn'
ID312807
Institutional Source Beutler Lab
Gene Symbol Dstn
Ensembl Gene ENSMUSG00000015932
Gene Namedestrin
Synonymssid23p, ADF, corn1, 2610043P17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3882 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location143915320-143943324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143942187 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 150 (E150G)
Ref Sequence ENSEMBL: ENSMUSP00000099461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103172]
Predicted Effect probably benign
Transcript: ENSMUST00000103172
AA Change: E150G

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099461
Gene: ENSMUSG00000015932
AA Change: E150G

DomainStartEndE-ValueType
ADF 19 153 2.67e-52 SMART
Meta Mutation Damage Score 0.2393 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying mutations at this locus develop irregular thickening of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,700 W24R probably damaging Het
Acy1 G T 9: 106,435,509 T181K possibly damaging Het
Adcy4 A G 14: 55,774,546 F581L probably benign Het
Amhr2 G A 15: 102,445,898 G48D probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgef17 A G 7: 100,876,454 F1979S possibly damaging Het
C2 T C 17: 34,873,489 T191A probably benign Het
Cmya5 T A 13: 93,091,219 T2454S probably benign Het
Dync1h1 G T 12: 110,629,058 V1444F probably benign Het
Eif3f T C 7: 108,940,955 V319A possibly damaging Het
Gpha2 T C 19: 6,226,889 probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Jup A G 11: 100,378,381 V402A probably benign Het
Kif18a A G 2: 109,306,974 N517S probably benign Het
Kif20b T A 19: 34,950,080 I874N probably damaging Het
Lepr T A 4: 101,815,265 V1162E probably damaging Het
Man2a2 A T 7: 80,362,315 V698D possibly damaging Het
Miip A C 4: 147,861,052 S376A possibly damaging Het
Nsun7 G A 5: 66,278,640 R285Q probably damaging Het
Nup210l T C 3: 90,124,210 V281A probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha8 C A 18: 36,993,046 L194I probably damaging Het
Pcdha8 A G 18: 36,993,571 I369V probably benign Het
Pcdhga10 C A 18: 37,747,441 A85E possibly damaging Het
Ppfibp1 A G 6: 146,998,221 R137G possibly damaging Het
Rcor1 C T 12: 111,103,753 A230V probably damaging Het
Scn3a T C 2: 65,482,279 M1191V probably benign Het
Skor2 A G 18: 76,862,689 D904G probably damaging Het
Suco A T 1: 161,834,744 V706E probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn1r83 A T 7: 12,321,402 C243S probably damaging Het
Wdr17 A T 8: 54,639,501 C1083S possibly damaging Het
Zfp952 G T 17: 33,001,975 E18* probably null Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Zscan25 G T 5: 145,291,052 G509C probably damaging Het
Other mutations in Dstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Dstn APN 2 143942174 missense probably benign
R0655:Dstn UTSW 2 143938422 missense probably damaging 1.00
R0849:Dstn UTSW 2 143938535 missense probably benign 0.42
R1405:Dstn UTSW 2 143938436 missense probably damaging 1.00
R1405:Dstn UTSW 2 143938436 missense probably damaging 1.00
R1460:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R1541:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R6419:Dstn UTSW 2 143939987 missense possibly damaging 0.75
R7402:Dstn UTSW 2 143938448 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCACAAATCCTTCCTCAATG -3'
(R):5'- ACCAGTGAGACCTTAGAGGC -3'

Sequencing Primer
(F):5'- GAGTCATAACGGAATGTCCACTTGTG -3'
(R):5'- AGACCTTAGAGGCTGGATTTAGG -3'
Posted On2015-04-30