Mutagenetix > Incidental Mutations

Incidental Mutation 'R0386:Gabrb1'

31281

Institutional Source

Beutler Lab

Gene Symbol

Gabrb1

Ensembl Gene

ENSMUSG00000029212

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit beta 1

Synonyms

Gabrb-1, B230208N19Rik

MMRRC Submission

038592-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0386 (G1)

Quality Score

203

Status

Validated

Chromosome

Chromosomal Location

71658113-72149037 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72108807 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 269 (Y269F)

Ref Sequence

ENSEMBL: ENSMUSP00000031122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031122
AA Change: Y269F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: Y269F

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	37	243	7.1e-52	PFAM
Pfam:Neur_chan_memb	250	469	2.4e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199967

SMART Domains

Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	4	210	4.8e-51	PFAM

Meta Mutation Damage Score

0.6529

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.5%
20x: 90.3%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,896,461	V194A	probably damaging	Het
Adamts13	G	A	2: 26,986,679		probably null	Het
Ahnak	T	C	19: 9,011,144	M3264T	possibly damaging	Het
Birc6	T	A	17: 74,599,340	C1409S	probably damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Dnah2	A	G	11: 69,447,861	V3161A	probably damaging	Het
Dnah5	A	T	15: 28,383,581	Y2983F	probably damaging	Het
Dnah6	G	A	6: 73,083,124	L2774F	probably damaging	Het
Dst	A	T	1: 34,217,836	T4398S	probably damaging	Het
Efcab5	G	A	11: 77,140,923	R42W	probably damaging	Het
Efcab5	A	T	11: 77,172,378	M96K	probably benign	Het
Elavl4	A	G	4: 110,206,705		probably benign	Het
Flt4	G	A	11: 49,644,386	A1214T	probably benign	Het
Fn1	G	T	1: 71,595,786	T2127N	probably damaging	Het
Foxj1	A	T	11: 116,331,803	S391R	possibly damaging	Het
Ghitm	A	G	14: 37,125,911	S259P	possibly damaging	Het
Gm16332	A	G	1: 139,924,190		noncoding transcript	Het
Gm16380	T	A	9: 53,884,443		noncoding transcript	Het
Gm9869	A	T	9: 60,838,062		probably benign	Het
Gm9936	G	A	5: 114,857,131	Q142*	probably null	Het
Hmbs	T	C	9: 44,337,008	Y260C	probably benign	Het
Hoxc5	T	A	15: 103,015,352	C193*	probably null	Het
Idh2	C	T	7: 80,098,257	A232T	probably damaging	Het
Lce1j	T	C	3: 92,789,388	K28E	unknown	Het
Lpgat1	C	T	1: 191,719,348		probably benign	Het
Lyst	T	C	13: 13,708,214		probably benign	Het
Megf11	A	G	9: 64,640,078	N235D	probably damaging	Het
Mst1r	T	A	9: 107,916,804		probably null	Het
Nr2c2ap	A	G	8: 70,131,587	D9G	probably benign	Het
Obscn	T	C	11: 59,136,339	T13A	probably damaging	Het
Ofcc1	A	C	13: 40,214,474	L188*	probably null	Het
Olfr1028	A	G	2: 85,951,873	E270G	probably damaging	Het
Olfr432	A	T	1: 174,050,399	T9S	probably benign	Het
Oma1	A	T	4: 103,325,201		probably benign	Het
Pcm1	T	C	8: 41,316,023	F1642S	probably damaging	Het
Pglyrp2	A	G	17: 32,420,862	M1T	probably null	Het
Pnpla5	G	T	15: 84,120,719	L144M	probably damaging	Het
Prdm10	C	A	9: 31,316,300	T67K	probably damaging	Het
Ralgapa1	A	T	12: 55,708,067	H1193Q	probably benign	Het
Sall1	A	G	8: 89,032,604	S291P	probably damaging	Het
Sdk2	T	C	11: 113,893,464	T150A	probably damaging	Het
Sel1l2	T	A	2: 140,275,441	Y170F	probably benign	Het
Sema4a	C	T	3: 88,436,800	V715I	possibly damaging	Het
Smgc	G	A	15: 91,854,638	A500T	probably benign	Het
Spef2	A	G	15: 9,584,062	V1639A	probably damaging	Het
Srrm4	A	G	5: 116,482,378		probably benign	Het
Tbc1d23	G	A	16: 57,189,273	H418Y	probably damaging	Het
Tbk1	A	G	10: 121,584,254	L10P	probably damaging	Het
Thumpd3	G	A	6: 113,065,660		probably null	Het
Trp53bp1	G	T	2: 121,204,943	T1609K	probably damaging	Het
Tut1	A	G	19: 8,955,555	N84S	probably benign	Het
Urb1	C	T	16: 90,796,399	G282R	probably damaging	Het
Usp19	A	T	9: 108,499,711	D1160V	probably damaging	Het
Usp9y	A	G	Y: 1,316,933	V1872A	probably damaging	Het
Zfp276	C	A	8: 123,259,503	Y386*	probably null	Het

Other mutations in Gabrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Gabrb1	APN	5	72108446	critical splice donor site	probably null
IGL00774:Gabrb1	APN	5	72108446	critical splice donor site	probably null
IGL01534:Gabrb1	APN	5	71869429	missense	possibly damaging	0.95
IGL02170:Gabrb1	APN	5	72136730	missense	probably damaging	1.00
IGL02326:Gabrb1	APN	5	71700847	missense	probably damaging	0.99
IGL03278:Gabrb1	APN	5	71869596	missense	probably damaging	1.00
IGL03345:Gabrb1	APN	5	72136565	missense	possibly damaging	0.53
IGL03050:Gabrb1	UTSW	5	72122154	missense	probably benign	0.03
PIT4445001:Gabrb1	UTSW	5	72108782	missense	probably damaging	1.00
PIT4515001:Gabrb1	UTSW	5	71700817	missense	probably damaging	1.00
R0109:Gabrb1	UTSW	5	72121946	splice site	probably benign
R1512:Gabrb1	UTSW	5	72108704	missense	probably damaging	1.00
R1512:Gabrb1	UTSW	5	72108705	missense	probably damaging	1.00
R1717:Gabrb1	UTSW	5	72108351	splice site	probably null
R1832:Gabrb1	UTSW	5	72121938	splice site	probably null
R1961:Gabrb1	UTSW	5	71700336	missense	probably benign	0.28
R2363:Gabrb1	UTSW	5	71869573	nonsense	probably null
R4686:Gabrb1	UTSW	5	71700022	missense	possibly damaging	0.53
R4840:Gabrb1	UTSW	5	71700811	missense	probably damaging	1.00
R4916:Gabrb1	UTSW	5	71869421	missense	probably damaging	1.00
R4941:Gabrb1	UTSW	5	72136778	missense	probably damaging	1.00
R5250:Gabrb1	UTSW	5	71869579	missense	possibly damaging	0.80
R5270:Gabrb1	UTSW	5	72108326	missense	probably damaging	1.00
R5364:Gabrb1	UTSW	5	72136762	missense	probably benign	0.33
R5407:Gabrb1	UTSW	5	72122021	missense	possibly damaging	0.90
R5621:Gabrb1	UTSW	5	72108728	missense	probably damaging	1.00
R5790:Gabrb1	UTSW	5	72136484	missense	possibly damaging	0.53
R6236:Gabrb1	UTSW	5	72108320	missense	probably damaging	1.00
R6336:Gabrb1	UTSW	5	72029898	missense	possibly damaging	0.72
R7411:Gabrb1	UTSW	5	72122195	critical splice donor site	probably null
R8375:Gabrb1	UTSW	5	72029829	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGTCCAAGAAGGTGGAGTTCACAAC -3'
(R):5'- AGTGTTTCCACAGTCAAAAGCAGGG -3'

Sequencing Primer
(F):5'- ctctctctctccctctccc -3'
(R):5'- CACTCATACGATGGGAAACATATTC -3'

Posted On

2013-04-24