Incidental Mutation 'R3882:Paxip1'
ID312810
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene NamePAX interacting (with transcription-activation domain) protein 1
SynonymsD5Ertd149e, PTIP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3882 (G1)
Quality Score215
Status Validated
Chromosome5
Chromosomal Location27740080-27791691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27748839 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 953 (R953Q)
Ref Sequence ENSEMBL: ENSMUSP00000002291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291]
Predicted Effect probably damaging
Transcript: ENSMUST00000002291
AA Change: R953Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: R953Q

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197625
Meta Mutation Damage Score 0.1145 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,700 W24R probably damaging Het
Acy1 G T 9: 106,435,509 T181K possibly damaging Het
Adcy4 A G 14: 55,774,546 F581L probably benign Het
Amhr2 G A 15: 102,445,898 G48D probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgef17 A G 7: 100,876,454 F1979S possibly damaging Het
C2 T C 17: 34,873,489 T191A probably benign Het
Cmya5 T A 13: 93,091,219 T2454S probably benign Het
Dstn A G 2: 143,942,187 E150G probably benign Het
Dync1h1 G T 12: 110,629,058 V1444F probably benign Het
Eif3f T C 7: 108,940,955 V319A possibly damaging Het
Gpha2 T C 19: 6,226,889 probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Jup A G 11: 100,378,381 V402A probably benign Het
Kif18a A G 2: 109,306,974 N517S probably benign Het
Kif20b T A 19: 34,950,080 I874N probably damaging Het
Lepr T A 4: 101,815,265 V1162E probably damaging Het
Man2a2 A T 7: 80,362,315 V698D possibly damaging Het
Miip A C 4: 147,861,052 S376A possibly damaging Het
Nsun7 G A 5: 66,278,640 R285Q probably damaging Het
Nup210l T C 3: 90,124,210 V281A probably benign Het
Pcdha8 C A 18: 36,993,046 L194I probably damaging Het
Pcdha8 A G 18: 36,993,571 I369V probably benign Het
Pcdhga10 C A 18: 37,747,441 A85E possibly damaging Het
Ppfibp1 A G 6: 146,998,221 R137G possibly damaging Het
Rcor1 C T 12: 111,103,753 A230V probably damaging Het
Scn3a T C 2: 65,482,279 M1191V probably benign Het
Skor2 A G 18: 76,862,689 D904G probably damaging Het
Suco A T 1: 161,834,744 V706E probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn1r83 A T 7: 12,321,402 C243S probably damaging Het
Wdr17 A T 8: 54,639,501 C1083S possibly damaging Het
Zfp952 G T 17: 33,001,975 E18* probably null Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Zscan25 G T 5: 145,291,052 G509C probably damaging Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27772552 utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27748859 missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27751038 missense probably benign 0.17
IGL02143:Paxip1 APN 5 27775598 utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27759395 missense probably benign 0.30
IGL02903:Paxip1 APN 5 27748872 missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27752766 missense probably benign 0.01
BB003:Paxip1 UTSW 5 27791209 missense unknown
BB013:Paxip1 UTSW 5 27791209 missense unknown
R0128:Paxip1 UTSW 5 27744185 splice site probably benign
R0130:Paxip1 UTSW 5 27744185 splice site probably benign
R0331:Paxip1 UTSW 5 27765232 missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27758623 splice site probably benign
R0370:Paxip1 UTSW 5 27760086 missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27765942 nonsense probably null
R1969:Paxip1 UTSW 5 27744136 missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27742501 missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27775673 utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27772029 unclassified probably benign
R3809:Paxip1 UTSW 5 27772029 unclassified probably benign
R3881:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27761677 splice site probably null
R4692:Paxip1 UTSW 5 27772097 unclassified probably benign
R4776:Paxip1 UTSW 5 27765206 missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27766284 missense unknown
R5388:Paxip1 UTSW 5 27781455 utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27772004 unclassified probably benign
R5553:Paxip1 UTSW 5 27775639 utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27761618 missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27766173 missense unknown
R6276:Paxip1 UTSW 5 27761668 missense probably damaging 1.00
R6290:Paxip1 UTSW 5 27765578 splice site probably null
R6584:Paxip1 UTSW 5 27758452 missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27744137 missense probably benign 0.18
R6908:Paxip1 UTSW 5 27791224 missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27765768 nonsense probably null
R7252:Paxip1 UTSW 5 27760086 missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27781420 critical splice donor site probably null
R7585:Paxip1 UTSW 5 27772004 missense unknown
R7665:Paxip1 UTSW 5 27765738 missense unknown
R7926:Paxip1 UTSW 5 27791209 missense unknown
R8169:Paxip1 UTSW 5 27772095 missense unknown
R8335:Paxip1 UTSW 5 27766124 missense unknown
X0066:Paxip1 UTSW 5 27766018 missense unknown
Z1176:Paxip1 UTSW 5 27783729 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATCAGAGTAAAGAATGTTCCTG -3'
(R):5'- TCACAGGATGAGTGTGGCTG -3'

Sequencing Primer
(F):5'- CAGTCTGATCTAGCTACACAGTGAG -3'
(R):5'- GTGGGTTGTATGGCCTGCC -3'
Posted On2015-04-30